ORFeome > MGC75970 – XORFeome 2.0

MGC75970 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75970, mRNA (cDNA clone MGC:75970 IMAGE:5384222), complete cds
Gene Symbol: MGC75970
Gene ID: 394630
ORF gb_acc: MG133017
ORF ID: 10405

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061393

Library Location

Plate ID: GDExt11004
Well Location: E05

EST Sequences

Clone: MGC:75970 IMAGE:5384222
Trimmed Sequence: ATGTCGGCTAGCGCAGTATATGTGCTAGACCTGAAAGGGAAGGTCCTTATTTGCCGGAATTACCGCGGTGATGTGGACATGTCAGAAGTGGAGCACTTCATGCCAATTTTGATGGAGAAAGAAGAAGAAGGAGCACTTTCACCAATTCTGGCGCATGGAGGTGTCCGGTTCATGTGGATTAAACACAACAATCTATACCTTGTTGCAACGTCTAAAAAGAATGCCTGTGTATCGTTGGTATTCTCCTTTCTGTACAAAGTAGTCCAGGTATTTTCTGAGTACTTTAAAGAGCTAGAAGAAGAAAGTATCCGTGATAATTTTGTAATTATATATGAGTTATTAGATGAGCTAATGGATTTTGGCTATCCTCAAACCACAGACAGCAAAATCTTACAAGAGTATATTACTCAAGAAGGTCATAAATTAGAAACTGGAGCACCCCGTCCTCCTGCCACAGTAACAAATGCTGTATCTTGGAGATCGGAAGGAATTAAATATAGGAAGAATGAAGTTTTCCTGGATGTCATAGAATCTGTCAACCTTTTGGTGAGTGCAAATGGAAACGTGTTACGCAGTGAGATAGTAGGGTCAATCAAAATGCGAGTGTTTCTTTCAGGAATGCCTGAGCTTCGTCTTGGATTAAATGATAAGGTTCTCTTTGAAAATACTGGACGTGGAAAGAGCAAGTCTGTAGAACTGGAGGATGTCAAGTTCCACCAGTGTGTACGCCTGTCAAGATTTGAAAATGACAGGACAATTTCCTTCATTCCTCCAGATGGGGAGTTTGAGCTCATGTCTTACCGTTTGAACACACATGTTAAGCCTCTAATCTGGATTGAATCTGTAATAGAAAAACATTCCCACAGTCGTATTGAATACATGATAAAGGCCAAAAGTCAGTTCAAGCGCAGATCTACTGCAAACAATGTTGAGATTCACATTCCTGTGCCAAATGATGCCGATTCTCCCAAGTTCAAGACCACAGTAGGAAGTGTCAAATGGGTTCCAGAAAATAGCGAAATTGTGTGGTCTATAAAGTCCTTCCCGGGCGGCAAGGAGTATCTCATGAGAGCTCACTTCGGTCTCCCAAGCGTGGAGGCAGAAGACAAAGAAGGAAAACCTCCAATCAGTGTGAAGTTTGAGATACCCTATTTTACAACTTCTGGAATTCAGGTTAGGTACTTGAAAATCATTGAAAAAAGTGGGTACCAGGCCTTACCATGGGTGCGGTATATCACCCAGAATGGAGATTATCAACTTCGAACTCAGTAA
Full Trace Sequence: caaatatcgactatggaaggacccgctttttgactaaatccgccatcttagtaagggaatgttaagtctctatgacagggctaaccggaagttacattgcgtttcctctctgagcggaccgctatcgaggtggataacggggatggtattgtgagaggactgaggataacgaagctttgggctagtgggcagcagcttggcttgcctttgcaggactatcttcggccgtaaggatgtcggctagcgcagtatatgtgctagacctgaaagggaaggtccttatttgccggaattaccgcggtgatgtggacatgtcagaagtggagcacttcatgccaattttgatggagaaagaagaagaaggagcactttcaccaattctggcgcatggaggtgtccggttcatgtggattaaacacaacaatctataccttgttgcaacgtctaaaaagaatgcctgtgtatcgttggtattctcctttctgtacaaagtagtccaggtattttctgagtactttaaagagctagaagaagaaagtatccgtgataattttgtaattatatatgagttattagatgagctaatggattttggctatcctcaaaccacagacagcaaaatcttacaagagtatattactcaagaaggtcataaattagaaactggagcaccccgtcctcctgccacagtaacaaatgctgtatcttggagatcggaaggaattaaatataggaagaatgaagttttcctggatgtcatagaatctgtcaaccttttggtgagtgcaaatggaaacgtgttacgcagtgagatagtagggtcaatcaaaatgcgagtgtttctttcaggaatgcctgagcttcgtcttggattaaatgataaggttctctttgaaaatactggacgtggaaagagcaagtctgtagaactggaggatgtcaagttccaccagtgtgtacgcctgtcaagatttgaaaatgacaggacaatttccttcattcctccagatggggagtttgagctcatgtcttaccgtttgaacacacatgttaagcctctaatctggattgaatctgtaatagaaaaacattcccacagtcgtattgaatacatgataaaggccaaaagtcagttcaagcgcagatctactgcaaacaatgttgagattcacattcctgtgccaaatgatgccgattctcccaagttcaagaccacagtaggaagtgtcaaatgggttccagaaaatagcgaaattgtgtggtctataaagtccttcccgggcggcaaggagtatctcatgagagctcacttcggtctcccaagcgtggaggcagaagacaaagaaggaaaacctccaatcagtgtgaagtttgagataccctattttacaacttctggaattcaggttaggtacttgaaaatcattgaaaaaagtgggtaccaggccttaccatgggtgcggtatatcacccagaatggagattatcaacttcgaactcagtaaaaagatttggtcaatgcatagccatatatataaatatatagtttaaactgtgattatatcgggatctgatttagttctgtggaatactaaaccgccaaatgcaaaggatctggatcctgcccatgtccgcagagcatatacattacagaaaaaaatgaagcatctggtagcagcatctgttggactcgcgctgctttctgtaaatgtgtttgttgtctcttgcgccattcccaggcccagccggaatttattgcagtgatcctaccagaaagacctgtaagacacatcaagttcattaaatgttctttatataaaaaaaaaaaaaaaaaa
Translation: MSASAVYVLDLKGKVLICRNYRGDVDMSEVEHFMPILMEKEEEGALSPILAHGGVRFMWIKHNNLYLVATSKKNACVSLVFSFLYKVVQVFSEYFKELEEESIRDNFVIIYELLDELMDFGYPQTTDSKILQEYITQEGHKLETGAPRPPATVTNAVSWRSEGIKYRKNEVFLDVIESVNLLVSANGNVLRSEIVGSIKMRVFLSGMPELRLGLNDKVLFENTGRGKSKSVELEDVKFHQCVRLSRFENDRTISFIPPDGEFELMSYRLNTHVKPLIWIESVIEKHSHSRIEYMIKAKSQFKRRSTANNVEIHIPVPNDADSPKFKTTVGSVKWVPENSEIVWSIKSFPGGKEYLMRAHFGLPSVEAEDKEGKPPISVKFEIPYFTTSGIQVRYLKIIEKSGYQALPWVRYITQNGDYQLRTQ
Donor tissue: neurula