ORFeome > MGC75979 – XORFeome 2.0

MGC75979 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC75979, mRNA (cDNA clone MGC:75979 IMAGE:5384319), complete cds
Gene Symbol: MGC75979
Gene ID: 394796
ORF gb_acc: MG133009
ORF ID: 10396

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063369

Library Location

Plate ID: GDExt11004
Well Location: F07

EST Sequences

Clone: MGC:75979 IMAGE:5384319
Trimmed Sequence: ATGTCTATCGAGATCGAGTCGTCTGATGTCATCCGTCTCATCATGCAGTACCTGAAAGAAAACAGTTTGCACCGTACTTTAGCAACGCTACAAGAAGAGACCACAGTGTCCTTGAACACTGTGGATAGTATTGAGAGCTTTGTGGCTGACATCAATAGTGGCCATTGGGATACTGTACTTCAAGCTATTCAGTCACTGAAACTGCCAGACAAGACTCTCATCGACCTCTATGAACAGGTTGTATTAGAACTAATTGAACTTCGTGAGCTGGGAGCTGCTAGATCCCTCCTGAGGCAAACAGACCCTATGATAATGTTAAAACAGAACCAACCAGAAAGATACATTCATCTTGAGAACTTACTGGCCAGATCATATTTTGACCCACGAGAGGCATACCCAGATGGAAGCAGCAAGGAAAAAAGGCGAGCTGCAATAGCTCAGGCATTGGCTGGGGAAGTAAGTGTTGTGCCTCCATCGCGTCTCATGGCGTTGCTTGGACAGGCATTAAAATGGCAGCAGCATCAGGGTCTTCTGCCCCCTGGTATGATCATTGATTTGTTCAGAGGTAAAGCTGCTGTAAAAGATGTAGAAGAAGAGAAGTTTCCTACACAACTTAGCAGGCATATTAAGTTTGGACAGAAATCACATGTTGAATGTGCTCGATTTTCTCCTGATGGCCAGTACCTTGTTACTGGTTCTGTTGATGGCTTTATTGAAGTCTGGAACTTCACCACTGGAAAAATCAGGAAGGATCTAAAATACCAGGCTCAAGACAACTTTATGATGATGGATGATGCTGTGTTGTGCATGTGCTTCAGTAGAGATACAGAAATGTTGGCAACAGGAGCTCAGGATGGCAAGATAAAGGTGTGGAAAATTCAGAGTGGACAATGTTTGAGGAGGTTTGAACGTGCTCATAGTAAAGGTGTCACATGTCTTAGTTTTTCCAAAGACTGTAGTCAGATCCTTAGTGCTTCGTTTGACCAGACTATCAGGGTTCATGGCTTAAAGTCTGGAAAAACACTAAAGGAATTTAGAGGACATTCTTCATTTGTGAATGAAGCAACATTTACTCAAGATGGTCACTATATTATCAGCGCTTCATCCGATGGCACAGTAAAGATATGGAATATGAAGACCACTGAGTGCTCGAATACCTTTAAATCGCTTGGAAGTACAGCTGGAACAGATATTACTGTAAACAGTGTCATTCTTTTGCCTAAAAATCCAGAACATTTTGTTGTGTGTAACCGTTCCAACACGGTGGTTATTATGAACATGCAAGGACAAATTGTAAGAAGCTTTAGCTCTGGTAAGAGAGAAGGTGGAGACTTTGTATGTTGCACCTTGTCTCCCAGAGGAGAGTGGATCTACTGTGTTGGTGAGGATTTTGTGCTTTACTGCTTCAGCACTGTGACAGGAAAACTGGAGAGAACCTTGACTGTCCACGAAAAAGATGTAATTGGAATTGCTCATCACCCACATCAGAATTTGATTGGTACTTATAGTGAAGATGGACTCCTCAAACTGTGGAAGCCATAG
Full Trace Sequence: gatttaagtggctggcgattctgaatatctgaaacagtctggtgtatttttaattggtctcagaaaaaatgtctatcgagatcgagtcgtctgatgtcatccgtctcatcatgcagtacctgaaagaaaacagtttgcaccgtactttagcaacgctacaagaagagaccacagtgtccttgaacactgtggatagtattgagagctttgtggctgacatcaatagtggccattgggatactgtacttcaagctattcagtcactgaaactgccagacaagactctcatcgacctctatgaacaggttgtattagaactaattgaacttcgtgagctgggagctgctagatccctcctgaggcaaacagaccctatgataatgttaaaacagaaccaaccagaaagatacattcatcttgagaacttactggccagatcatattttgacccacgagaggcatacccagatggaagcagcaaggaaaaaaggcgagctgcaatagctcaggcattggctggggaagtaagtgttgtgcctccatcgcgtctcatggcgttgcttggacaggcattaaaatggcagcagcatcagggtcttctgccccctggtatgatcattgatttgttcagaggtaaagctgctgtaaaagatgtagaagaagagaagtttcctacacaacttagcaggcatattaagtttggacagaaatcacatgttgaatgtgctcgattttctcctgatggccagtaccttgttactggttctgttgatggctttattgaagtctggaacttcaccactggaaaaatcaggaaggatctaaaataccaggctcaagacaactttatgatgatggatgatgctgtgttgtgcatgtgcttcagtagagatacagaaatgttggcaacaggagctcaggatggcaagataaaggtgtggaaaattcagagtggacaatgtttgaggaggtttgaacgtgctcatagtaaaggtgtcacatgtcttagtttttccaaagactgtagtcagatccttagtgcttcgtttgaccagactatcagggttcatggcttaaagtctggaaaaacactaaaggaatttagaggacattcttcatttgtgaatgaagcaacatttactcaagatggtcactatattatcagcgcttcatccgatggcacagtaaagatatggaatatgaagaccactgagtgctcgaatacctttaaatcgcttggaagtacagctggaacagatattactgtaaacagtgtcattcttttgcctaaaaatccagaacattttgttgtgtgtaaccgttccaacacggtggttattatgaacatgcaaggacaaattgtaagaagctttagctctggtaagagagaaggtggagactttgtatgttgcaccttgtctcccagaggagagtggatctactgtgttggtgaggattttgtgctttactgcttcagcactgtgacaggaaaactggagagaaccttgactgtccacgaaaaagatgtaattggaattgctcatcacccacatcagaatttgattggtacttatagtgaagatggactcctcaaactgtggaagccatagtgtgcgtctggaccttgttctacccttctttgcttcatagaaacattgtcatttaagatcaggtattggttcctaccagtacagggaaatacttatgttgacatagtaggtctgtaaatatgttttttttttttaaattgtgtttgaaaactgtgaccaagaatgtactgttgtacttattggtaatcttttaataccaaggagtaaataaagctgaaggattcgtcaacacttattttaatatcactagattccacaaggcaagtaaaacacatcaaaatacttaaatttatagttttacccaggcattttgcctttctttgctagtgttaggctgcatatttttccctgttattcattgatagatgtcagtgtcaccaacacaatccaactaagaggagagcaaatgacagttttccaatatctggaattcacaacaagtaattctagtatccgctgcagctccttatggtattaccatttttattttaactacaaactaaaatgttggttttcccttctgattattatgaatggccaacaatttatgaaagggaaatagtgtctatatttaagtctaagtgattttgaaccacaataacttctgaacagaccatcacctataaacagcagactctctgtatctgtcaactggaccagctgtatggcataaaattctgaattcaattaaaaaaatgttatgtataatatgcatatataatgtttagtatacattaaatattactttttttgtttttttttccccaattctgtttgctcagatgactgaagatcatgaccgtttgattagaagtcataaacatttttattttttcattatattcagaatataagaaaatgtttctgtttattttgtcattgcattatggtcattcataataaaaaaaaaaaaaaa
Translation: MSIEIESSDVIRLIMQYLKENSLHRTLATLQEETTVSLNTVDSIESFVADINSGHWDTVLQAIQSLKLPDKTLIDLYEQVVLELIELRELGAARSLLRQTDPMIMLKQNQPERYIHLENLLARSYFDPREAYPDGSSKEKRRAAIAQALAGEVSVVPPSRLMALLGQALKWQQHQGLLPPGMIIDLFRGKAAVKDVEEEKFPTQLSRHIKFGQKSHVECARFSPDGQYLVTGSVDGFIEVWNFTTGKIRKDLKYQAQDNFMMMDDAVLCMCFSRDTEMLATGAQDGKIKVWKIQSGQCLRRFERAHSKGVTCLSFSKDCSQILSASFDQTIRVHGLKSGKTLKEFRGHSSFVNEATFTQDGHYIISASSDGTVKIWNMKTTECSNTFKSLGSTAGTDITVNSVILLPKNPEHFVVCNRSNTVVIMNMQGQIVRSFSSGKREGGDFVCCTLSPRGEWIYCVGEDFVLYCFSTVTGKLERTLTVHEKDVIGIAHHPHQNLIGTYSEDGLLKLWKP
Donor tissue: neurula