ORFeome > MGC76048 – XORFeome 2.0

MGC76048 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76048, mRNA (cDNA clone MGC:76048 IMAGE:5307175), complete cds
Gene Symbol: MGC76048
Gene ID: 394697
ORF gb_acc: MG132763
ORF ID: 10067

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062496

Library Location

Plate ID: GDExt11001
Well Location: B11

EST Sequences

Clone: MGC:76048 IMAGE:5307175
Trimmed Sequence: ATGATACGGGGGGCAGTGCTGCTGGCATGGGTGCTGTGTGTGGGTGCCGCCCCGCAGGATTTAATGGACGTCTGTATGGATGGGAAGCACCAGAAGGTTGAACCGGGGAAGGAAGATGCTTTACATGGGCAGTGCACCCCCTGGAAGGACAAATCCTGCTGCACAGCGAATACCAGTCAGGAGGCCCATAATGACCAGTCCTACCTGTACAACTTCAACTGGGACCATTGCGGCATCATGGCCCCCGCCTGCAAGACCCACTTCATCCAGGACACCTGCTTCTACGAGTGCTCCCCAAACCTGGGGCCCTGGATCCAGAAGGTCGACAGCTCGTGGAGGAAGGAGCGGATCCTGGACGTCCCTCTGTGCCGGGAGGACTGTGACGGTTGGTACAACGACTGCAAACTGGAATATACCTGCATGGAAAACTGGCACAAGGGCTGGAACTGGACCTCGGGAACCAACCAGTGCCCAAATGGAACCAAGTGCCGCCGGGTGTTTGAGGTGTTTCCCAGCGCCGCCGATTTCTGTGAGAAGATTTGGAGCAATTCGTACAAATACAGTGATGAGCGTCGGGGCAGCGGGCGGTGCATGCAGCTCTGGTTCAACGCGACCAATGGCAACCCCAACGTGGCCGTGGCAAAGCACTACGCCGGCATCCCCAGCTCTGCCAGGAACCCCCGGATTGGGCTGCTGCTCCTGGCGCCTCTCAGCCTGGCACCTCTCAGCCTGGCATGGGCTGTATAA
Full Trace Sequence: cgctgctccttcctggtcgtctgtgggtcccggcgcgtgccatgctgtgtggaaccatgatacggggggcagtgctgctggcatgggtgctgtgtgtgggtgccgccccgcaggatttaatggacgtctgtatggatgggaagcaccagaaggttgaaccggggaaggaagatgctttacatgggcagtgcaccccctggaaggacaaatcctgctgcacagcgaataccagtcaggaggcccataatgaccagtcctacctgtacaacttcaactgggaccattgcggcatcatggcccccgcctgcaagacccacttcatccaggacacctgcttctacgagtgctccccaaacctggggccctggatccagaaggtcgacagctcgtggaggaaggagcggatcctggacgtccctctgtgccgggaggactgtgacggttggtacaacgactgcaaactggaatatacctgcatggaaaactggcacaagggctggaactggacctcgggaaccaaccagtgcccaaatggaaccaagtgccgccgggtgtttgaggtgtttcccagcgccgccgatttctgtgagaagatttggagcaattcgtacaaatacagtgatgagcgtcggggcagcgggcggtgcatgcagctctggttcaacgcgaccaatggcaaccccaacgtggccgtggcaaagcactacgccggcatccccagctctgccaggaacccccggattgggctgctgctcctggcgcctctcagcctggcacctctcagcctggcatgggctgtataagggggggtcccagccctcatgtactaaagcatcagctccgcccccttgtctgccaactgggtctcaatatggcgtccgccctgcgccattagtttgcaggtaggtagtgaagttctgatggaaacccattgcctacaaaccagcgacatggccaatgtacttgtatcactcctaaaatacagatggcagctcctttggaccgttactaaggggtccccttagtaacacggccacttcccactccagtaacccatgggacctgctttccatttctctacctctgcgggaccagttaaagctgattggttggtctggataattgggggtggagcaaaacttaagacccttggactcccagcgcctcatggtgcttcttcccctggaaatgtctcattgctttatgcacccggcgtaacaacatagggagctgcactgctgtgacccgactccgtataactcactatatcacatggggagatccctgcgcctctatgtgccccgggcccaacccaataaagttctgggtgggaaaaccataaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MIRGAVLLAWVLCVGAAPQDLMDVCMDGKHQKVEPGKEDALHGQCTPWKDKSCCTANTSQEAHNDQSYLYNFNWDHCGIMAPACKTHFIQDTCFYECSPNLGPWIQKVDSSWRKERILDVPLCREDCDGWYNDCKLEYTCMENWHKGWNWTSGTNQCPNGTKCRRVFEVFPSAADFCEKIWSNSYKYSDERRGSGRCMQLWFNATNGNPNVAVAKHYAGIPSSARNPRIGLLLLAPLSLAPLSLAWAV
Donor tissue: gastrula