ORFeome > MGC76054 – XORFeome 2.0

MGC76054 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76054, mRNA (cDNA clone MGC:76054 IMAGE:5307310), complete cds
Gene Symbol: MGC76054
Gene ID: 394948
ORF gb_acc: MG132752
ORF ID: 10055

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063904

Library Location

Plate ID: GDExt11001
Well Location: A11

EST Sequences

Clone: MGC:76054 IMAGE:5307310
Trimmed Sequence: ATGACAGACTATGACGAGGCGACCTCGTTCCTGGGAGAATGGGGCCGCTACCAGTTTATGATTTTCTTCTTGCTCAGCGCCAGCATCATCCCCAATGGCTTCAATGGTATGTCTGTCATGTTCCTGGCTGGCATCCCCGAGCATCGGTGCCACATACCGGAGAGCGCCAACCTGAGCGCCGCTTGGAGGAATGCGAGCATCCCCCGGCAGGACGGGCAGGACAGTCAGTGCCGGAGATACCGGCTGGGGACCCTCACTAACTACTCGGCTCTGGGGCTGCTCCCCGGGCGGGATGTGGATGTGACTGGGATAGAGCAAGAGCCGTGTCTGGATGGCTGGAACTACAGCAAATCCCTTTACCTGTCAACTATCGTCACTGAGTGGGACATTGTGTGTGAAAATGACTGGAAGGGACCATTAACAACATCATTGTTTTTTGTTGGTGTGCTACTTGGTTCATTTGTTTCCGGTCAACTATCAGACAGTTTTGGAAGAAAGAAAATTCTTTTTGTGACCATGGCTATACAGACTGGCTTCAGCATTGTACAGGTTTTCTCTACTAGCTGGGAAATGTTTGCCATTCTTTTCCTCATTGTTGGAATGGGTCAGATTTCCAACTATGTTGCAGCTTTCATATTAGGGACGGAAATTCTTGGCAAGTCTGCTAGAATCATCTTTTCTACCTTGGGTACATGCATATTTTTTGCAATTGGCTACATGATGTTGCCACTGTTTGCTTACTTCATTAGAGACTGGAGAACACTCTTACTGGCTCTCACTATTCCTGGTCTATTCTGTATTCCACTGTGGTGGATTATACCAGAATCTCCACAGTGGCTCATCTGTAAGGGCAGGCTAGAGGAAGCAGAAGTCATCATCCGAAAGGCAGCAAAGATAAATAGAGTCCCAGCCCCTGCTGTCATATTTAAAACTACTGAACTGGAAGATATAGCAGAACGGCAGAAGAGAAGCTACACGCTTCTGGATCTTGTGAAGACCTTTAACGTTCGCATCATCACAATAATGACTGTATTTCTTTGGTTGATCACATCTATTGGATATTTTGGTATTTCACTGAACACCCCTAATTTACATGGAGATCCATTCTTAAATTGCTTTCTTCTTGCTGCCATTGAAGTTCCATCAAACATTTTCGCCTGGTTGCTTTTAAGATACATATCAAGACGTTATTCAATGTGCGGTTCCTTGCTGCTAGGTGGGGTTGTTCTTCTTCTCATTCAGCTGGTCCCTCTAGATCTTCAGATCTTATCTACTGTTCTGGTTATGGTGGGGAAGTTTGGGGTCACAGCAGCTTTTTCCATGGTGTATGTTTACACAGCTGAACTTTACCCTACCGTAATTAGAAACACAGGTGTTGGAATTGGATCAGTGTCATCCCGAATAGGAAGCGTCATTTCTCCATATTTTGTTTACCTTGGTGCTTACAATAGATTGCTGCCTTATATTCTCATGGGGAGTCTGACTGTGGCTAATGGAATCCTGGTCTTATTCTTCCCAGAAACCTTTGGGAAACCCCTCCCAGAGACGATTGAGCAGACACAAAGCATCAAAGGGTTATGCTGCAGAAGAAAGATACACAGAGAAGATATTGCATACCCAGAAGTCAAGAAAAACTGTATTTTGATCAACACAAAGTTATGA
Full Trace Sequence: ctactttataatgacagactatgacgaggcgacctcgttcctgggagaatggggccgctaccagtttatgattttcttcttgctcagcgccagcatcatccccaatggcttcaatggtatgtctgtcatgttcctggctggcatccccgagcatcggtgccacataccggagagcgccaacctgagcgccgcttggaggaatgcgagcatcccccggcaggacgggcaggacagtcagtgccggagataccggctggggaccctcactaactactcggctctggggctgctccccgggcgggatgtggatgtgactgggatagagcaagagccgtgtctggatggctggaactacagcaaatccctttacctgtcaactatcgtcactgagtgggacattgtgtgtgaaaatgactggaagggaccattaacaacatcattgttttttgttggtgtgctacttggttcatttgtttccggtcaactatcagacagttttggaagaaagaaaattctttttgtgaccatggctatacagactggcttcagcattgtacaggttttctctactagctgggaaatgtttgccattcttttcctcattgttggaatgggtcagatttccaactatgttgcagctttcatattagggacggaaattcttggcaagtctgctagaatcatcttttctaccttgggtacatgcatattttttgcaattggctacatgatgttgccactgtttgcttacttcattagagactggagaacactcttactggctctcactattcctggtctattctgtattccactgtggtggattataccagaatctccacagtggctcatctgtaagggcaggctagaggaagcagaagtcatcatccgaaaggcagcaaagataaatagagtcccagcccctgctgtcatatttaaaactactgaactggaagatatagcagaacggcagaagagaagctacacgcttctggatcttgtgaagacctttaacgttcgcatcatcacaataatgactgtatttctttggttgatcacatctattggatattttggtatttcactgaacacccctaatttacatggagatccattcttaaattgctttcttcttgctgccattgaagttccatcaaacattttcgcctggttgcttttaagatacatatcaagacgttattcaatgtgcggttccttgctgctaggtggggttgttcttcttctcattcagctggtccctctagatcttcagatcttatctactgttctggttatggtggggaagtttggggtcacagcagctttttccatggtgtatgtttacacagctgaactttaccctaccgtaattagaaacacaggtgttggaattggatcagtgtcatcccgaataggaagcgtcatttctccatattttgtttaccttggtgcttacaatagattgctgccttatattctcatggggagtctgactgtggctaatggaatcctggtcttattcttcccagaaacctttgggaaacccctcccagagacgattgagcagacacaaagcatcaaagggttatgctgcagaagaaagatacacagagaagatattgcatacccagaagtcaagaaaaactgtattttgatcaacacaaagttatgatgaaagacatctgccattgtgcagagtcttaattatcatgtgaaagtctgaaacattccaaaaaatcctggacagttctttaaaagggcttcaaagaatcttaaaccatggcctaaggaacaaaactgagaacacttgaattttttggacagttaatgtttatttttatcactctatttttttttatttgggtttcatggagtagaaggtgaaacaaagggtttgagggtagctgtttcactctcaatttcaaatagctgttaatctgacttaaaaaatcagaaatctctttggaagttactactttggaaaactttttcaagttttattggacatggaattacagtggatttaagtttgttttcctgacacaacagaaaaagactctaatgtaagagtgaaataacagtagtgattttaaataattacaatgaatacaacaacagatataacctattgcataactgatgctcccttggcagcaattccagcctggcaaaactgcttatactctcagattaaactggggccatgagggaactgccctttttcagccataaattcctctgttggattgagatttggagtaccctggaagatgcagatatatataagccattcttgtagttttgcctttatgcttggactcaatgtcttactgaaatacacttcttttcccaaggctttcaaaaaaaaaaaaaaaaaa
Translation: MTDYDEATSFLGEWGRYQFMIFFLLSASIIPNGFNGMSVMFLAGIPEHRCHIPESANLSAAWRNASIPRQDGQDSQCRRYRLGTLTNYSALGLLPGRDVDVTGIEQEPCLDGWNYSKSLYLSTIVTEWDIVCENDWKGPLTTSLFFVGVLLGSFVSGQLSDSFGRKKILFVTMAIQTGFSIVQVFSTSWEMFAILFLIVGMGQISNYVAAFILGTEILGKSARIIFSTLGTCIFFAIGYMMLPLFAYFIRDWRTLLLALTIPGLFCIPLWWIIPESPQWLICKGRLEEAEVIIRKAAKINRVPAPAVIFKTTELEDIAERQKRSYTLLDLVKTFNVRIITIMTVFLWLITSIGYFGISLNTPNLHGDPFLNCFLLAAIEVPSNIFAWLLLRYISRRYSMCGSLLLGGVVLLLIQLVPLDLQILSTVLVMVGKFGVTAAFSMVYVYTAELYPTVIRNTGVGIGSVSSRIGSVISPYFVYLGAYNRLLPYILMGSLTVANGILVLFFPETFGKPLPETIEQTQSIKGLCCRRKIHREDIAYPEVKKNCILINTKL
Donor tissue: gastrula