ORFeome > MGC76056 – XORFeome 2.0

MGC76056 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76056, mRNA (cDNA clone MGC:76056 IMAGE:5307366), complete cds
Gene Symbol: MGC76056
Gene ID: 407861
ORF gb_acc: MG133455
ORF ID: 10976

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067313

Library Location

Plate ID: GDExt11009
Well Location: B12

EST Sequences

Clone: MGC:76056 IMAGE:5307366
Trimmed Sequence: ATGACTAAATTAGGATTTTTGCGTCTGTCCTATGAGAAGCAGGACACTCTCCTCAAGCTCCTCATCCTGTCTATGGCAGCAATTCTCTCCTTCTCTACCAGATTGTTCTCGGTTTTGAGATTTGAAAGTGTCATTCATGAGTTTGATCCGTATTTCAATTATCGAACAACAAGGTTTCTTGCCGAGGAAGGATTTTATAATTTCCATAACTGGTTTGATGATCGAGCATGGTATCCATTGGGAAGAATTATAGGAGGAACAATCTATCCAGGTCTGATGATAACCTCTGCAGCATTCTACCATATTCTACACTTTTTCCACATCACTATTGACATCCGAAATGTTTGTGTATTCCTTGCTCCACTCTTCTCGTCTTTCACCACCATAGTCACTTACCATCTGACAAAAGAGCTGAAAGATGCTGGTGCAGGCCTTTTGGCAGCAGCAATGATAGCAGTGGTGCCTGGCTATATATCACGTTCTGTGGCTGGATCCTATGATAATGAAGGTATTGCCATTTTCTGTATGCTTCTAACTTACTACATGTGGATTAAGGCAGTAAAGACTGGTTCAATCTATTGGGCAGCCATGTGCGCTCTAGCATATTTCTATATGGTCTCCTCGTGGGGAGGATACGTGTTTCTGATCAACCTTATACCACTTCATGTCCTGGTTTTGATGCTTACCGGAAGATTCTCTCATCGAATTTATGTGGCTTACTGCACAGTTTATTGTTTGGGCACCATCCTCTCCATGCAGATCTCCTTTGTTGGATTTCAGCCTGTCTTGTCATCTGAGCACATGGCCGCCTTAGGAGTTTTTGGCCTGTGTCAGATCCATGCTTTTGTAGACTACCTGCGGAGCAAGCTCAATCCTCAGCAATTTGAAATTCTTTTTAGGAGTGTGATTTCACTGGTTGGATTTGTTCTTCTCACTGTCGGAGCTGTCCTCATGCTGACCGGCAAAATATCCCCATGGACTGGTCGTTTCTATTCCCTTTTGGATCCTTCTTATGCAAAGAACAATATTCCAATCATTGCTTCTGTATCTGAGCATCAGCCCACGACATGGTCTTCTTATTATTTTGATTTGCAGTTACTTGTCTTCATGTTTCCAGTTGGTCTGTATTATTGCTTCAGTAATCTATCTGATGCCAGAATTTTCATTATCATGTACGGTGTGACCAGTATGTACTTTTCTGCAGTCATGGTGCGTCTGATGCTGGTTCTTGCCCCTGTTATGTGTATTCTTTCTGGCATTGGGGTTTCTCAGGTATTATCCACTTACATGAAGAATCTTGACATTAGCCGTCCTGATAAAAAAACAAAAAAGCAACAGGATTCTACATATCCCATCAAAAACGAAGTTGCCAGTGGCATGATCCTGGTCATGGCTTTCTTTTTGGTCACTTATACATTCCACTCTACATGGGTGACAAGTGAAGCTTACTCCTCTCCCTCTATTGTTCTGTCAGCCCGTGGTGGAGATGGTAGCAGGATCATCTTTGATGATTTCAGGGAGGCTTATTATTGGCTCAGACACAACACCCCTGAGGATGCAAAAGTAATGTCGTGGTGGGATTATGGTTACCAGATTACAGCAATGGCCAATCGAACAATCCTCGTTGATAATAATACCTGGAATAACACACACATTTCCAGAGTAGGCCAGGCAATGGCATCCACTGAAGAAAAAGCCTATGAGATTATGAGAGAGCTGGATGTTAGTTATGTCCTTGTTATTTTTGGGGGCCTCACAGGATATTCATCAGATGATATCAACAAATTTTTGTGGATGGTAAGAATTGGAGGAAGCACTGACACTGGTAAACACATCAAAGAGCACGATTACTACACTCCTACTGGAGAGTTTCGTGTAGATAGAGAAGGATCTCCCGTTCTGCTCAACTGCCTTATGTACAAGATGTGCTATTATCGCTTTGGTCAAGTCTACACCGAAGCCAAACGCCCTCCAGGTTATGACAGAGTGAGAAACGCAGAAATCGGCAATAAAGATTTCGAGCTTGATGTTCTAGAGGAAGCTTACACCACAGAGCACTGGCTTGTCAGAATATATAAAGTAAAAGATCTGGATAATCGAGGGTTATCAAGAACATAA
Full Trace Sequence: ggggagagcagagggagaggagcggctgccaggtttctagtgttttctgtcccttccctttatgtaaaatgactaaattaggatttttgcgtctgtcctatgagaagcaggacactctcctcaagctcctcatcctgtctatggcagcaattctctccttctctaccagattgttctcggttttgagatttgaaagtgtcattcatgagtttgatccgtatttcaattatcgaacaacaaggtttcttgccgaggaaggattttataatttccataactggtttgatgatcgagcatggtatccattgggaagaattataggaggaacaatctatccaggtctgatgataacctctgcagcattctaccatattctacactttttccacatcactattgacatccgaaatgtttgtgtattccttgctccactcttctcgtctttcaccaccatagtcacttaccatctgacaaaagagctgaaagatgctggtgcaggccttttggcagcagcaatgatagcagtggtgcctggctatatatcacgttctgtggctggatcctatgataatgaaggtattgccattttctgtatgcttctaacttactacatgtggattaaggcagtaaagactggttcaatctattgggcagccatgtgcgctctagcatatttctatatggtctcctcgtggggaggatacgtgtttctgatcaaccttataccacttcatgtcctggttttgatgcttaccggaagattctctcatcgaatttatgtggcttactgcacagtttattgtttgggcaccatcctctccatgcagatctcctttgttggatttcagcctgtcttgtcatctgagcacatggccgccttaggagtttttggcctgtgtcagatccatgcttttgtagactacctgcggagcaagctcaatcctcagcaatttgaaattctttttaggagtgtgatttcactggttggatttgttcttctcactgtcggagctgtcctcatgctgaccggcaaaatatccccatggactggtcgtttctattcccttttggatccttcttatgcaaagaacaatattccaatcattgcttctgtatctgagcatcagcccacgacatggtcttcttattattttgatttgcagttacttgtcttcatgtttccagttggtctgtattattgcttcagtaatctatctgatgccagaattttcattatcatgtacggtgtgaccagtatgtacttttctgcagtcatggtgcgtctgatgctggttcttgcccctgttatgtgtattctttctggcattggggtttctcaggtattatccacttacatgaagaatcttgacattagccgtcctgataaaaaaacaaaaaagcaacaggattctacatatcccatcaaaaacgaagttgccagtggcatgatcctggtcatggctttctttttggtcacttatacattccactctacatgggtgacaagtgaagcttactcctctccctctattgttctgtcagcccgtggtggagatggtagcaggatcatctttgatgatttcagggaggcttattattggctcagacacaacacccctgaggatgcaaaagtaatgtcgtggtgggattatggttaccagattacagcaatggccaatcgaacaatcctcgttgataataatacctggaataacacacacatttccagagtaggccaggcaatggcatccactgaagaaaaagcctatgagattatgagagagctggatgttagttatgtccttgttatttttgggggcctcacaggatattcatcagatgatatcaacaaatttttgtggatggtaagaattggaggaagcactgacactggtaaacacatcaaagagcacgattactacactcctactggagagtttcgtgtagatagagaaggatctcccgttctgctcaactgccttatgtacaagatgtgctattatcgctttggtcaagtctacaccgaagccaaacgccctccaggttatgacagagtgagaaacgcagaaatcggcaataaagatttcgagcttgatgttctagaggaagcttacaccacagagcactggcttgtcagaatatataaagtaaaagatctggataatcgagggttatcaagaacataattttttttgccttcagctttaatacaaacagcactgaaagagccttcacctgtgaaccagaagattttttttatactgtttctattgacggaaagaaagaacttatttggctgtggaagtcacactggttgctgtcgatgttgggtggaatgctttttatgaatatgaatgctaccaaaatgatttttttgttgttctgactttaccgtggtcaattaaagatggggaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTKLGFLRLSYEKQDTLLKLLILSMAAILSFSTRLFSVLRFESVIHEFDPYFNYRTTRFLAEEGFYNFHNWFDDRAWYPLGRIIGGTIYPGLMITSAAFYHILHFFHITIDIRNVCVFLAPLFSSFTTIVTYHLTKELKDAGAGLLAAAMIAVVPGYISRSVAGSYDNEGIAIFCMLLTYYMWIKAVKTGSIYWAAMCALAYFYMVSSWGGYVFLINLIPLHVLVLMLTGRFSHRIYVAYCTVYCLGTILSMQISFVGFQPVLSSEHMAALGVFGLCQIHAFVDYLRSKLNPQQFEILFRSVISLVGFVLLTVGAVLMLTGKISPWTGRFYSLLDPSYAKNNIPIIASVSEHQPTTWSSYYFDLQLLVFMFPVGLYYCFSNLSDARIFIIMYGVTSMYFSAVMVRLMLVLAPVMCILSGIGVSQVLSTYMKNLDISRPDKKTKKQQDSTYPIKNEVASGMILVMAFFLVTYTFHSTWVTSEAYSSPSIVLSARGGDGSRIIFDDFREAYYWLRHNTPEDAKVMSWWDYGYQITAMANRTILVDNNTWNNTHISRVGQAMASTEEKAYEIMRELDVSYVLVIFGGLTGYSSDDINKFLWMVRIGGSTDTGKHIKEHDYYTPTGEFRVDREGSPVLLNCLMYKMCYYRFGQVYTEAKRPPGYDRVRNAEIGNKDFELDVLEEAYTTEHWLVRIYKVKDLDNRGLSRT
Donor tissue: gastrula