ORFeome > MGC76063 – XORFeome 2.0

MGC76063 – XORFeome 2.0

General Information

Species: Xenopus tropicalis COP9 signalosome subunit 5, mRNA (cDNA clone MGC:76063 IMAGE:5307562), complete cds
Gene Symbol: MGC76063
Gene ID: 394714
ORF gb_acc: MG132742
ORF ID: 10043

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062499

Library Location

Plate ID: GDExt11001
Well Location: H10

EST Sequences

Clone: MGC:76063 IMAGE:5307562
Trimmed Sequence: ATGGCCATGGCTGGGAGCAGCGTGGCCCAGAAGACATGGGAGCTCTCCAATAACATGCAGGAGGTGCAGAGCATCGATGAGATCTATAAATACGATAAGAAGCAGCAGCAGGAGATCCTAGCAGCCAAACCATGGACAAAGGACCATCATTACTTCAAGTACTGCAAAGTGTCTGCCCTAGCCCTGCTGAAGATGGTCATGCACGCCAGATCAGGAGGGAACCTTGAGGTGATGGGCCTCATGCTTGGAAAAGTGGACGGGGAGACTATGATCATTATGGACAGTTTTGCTTTACCAGTTGAAGGAACTGAAACCAGAGTCAATGCTCAGGCTGCTGCTTATGAATACATGGCTGCATATATTGAAAATGCAAAGCAGGTTGGAAGACTTGAAAATGCAATAGGCTGGTACCACAGTCACCCTGGCTATGGCTGTTGGCTTTCTGGCATAGATGTCAGCACCCAGATGCTTAATCAGCAGTTTCAAGAACCCTTTGTTGCAGTAGTGATTGATCCAACAAGAACAATATCTGCTGGCAAAGTTAATCTTGGTGCATTCAGAACATATCCAAAGGGCTATAAACCTCCAGATGAGGGTCCGTCAGAGTACCAGACGATTCCTTTGAACAAAATAGAAGATTTTGGGGTGCATTGTAAGCAGTATTATGCCTTGGAGGTTACATATTTCAAATCATCTTTGGACCGAAAACTTCTTGAGCTGTTGTGGAATAAATATTGGGTGAATACACTGAGTTCCTCTAGCCTTCTGACAAACGCGGATTACACAACCGGACAGGTATTTGATTTATCGGAGAAATTAGAGCAGTCTGAAGCCCAGCTTGGTCGAGGGAGTTTCATGCTTGGATTAGAAACTCATGACCGAAAATCTGAGGATAAACTGGCAAAAGCAACAAGGGACAGCTGCAAGACAACCATTGAAGCCATCCATGGATTGATGTCACAAGTGATTAAAGATAAATTGTTCAACCAGATCAATACTGCCTAA
Full Trace Sequence: gaagaggccatggccatggctgggagcagcgtggcccagaagacatgggagctctccaataacatgcaggaggtgcagagcatcgatgagatctataaatacgataagaagcagcagcaggagatcctagcagccaaaccatggacaaaggaccatcattacttcaagtactgcaaagtgtctgccctagccctgctgaagatggtcatgcacgccagatcaggagggaaccttgaggtgatgggcctcatgcttggaaaagtggacggggagactatgatcattatggacagttttgctttaccagttgaaggaactgaaaccagagtcaatgctcaggctgctgcttatgaatacatggctgcatatattgaaaatgcaaagcaggttggaagacttgaaaatgcaataggctggtaccacagtcaccctggctatggctgttggctttctggcatagatgtcagcacccagatgcttaatcagcagtttcaagaaccctttgttgcagtagtgattgatccaacaagaacaatatctgctggcaaagttaatcttggtgcattcagaacatatccaaagggctataaacctccagatgagggtccgtcagagtaccagacgattcctttgaacaaaatagaagattttggggtgcattgtaagcagtattatgccttggaggttacatatttcaaatcatctttggaccgaaaacttcttgagctgttgtggaataaatattgggtgaatacactgagttcctctagccttctgacaaacgcggattacacaaccggacaggtatttgatttatcggagaaattagagcagtctgaagcccagcttggtcgagggagtttcatgcttggattagaaactcatgaccgaaaatctgaggataaactggcaaaagcaacaagggacagctgcaagacaaccattgaagccatccatggattgatgtcacaagtgattaaagataaattgttcaaccagatcaatactgcctaatgtttcattttgcaaagattcaagattggctgtctgtcttgttcaaataagttgcttcttttatgcagaggccagagattttcatctgggttgcactttttgtttgtttaaacctatggaaagcaaaggacatttattgtgacattcttgaaatattcccatttattggattggagctctctaagtaaatacaatattttaaactgtaaaaaaaaaacaaaaaaaaaaaaaaaaa
Translation: MAMAGSSVAQKTWELSNNMQEVQSIDEIYKYDKKQQQEILAAKPWTKDHHYFKYCKVSALALLKMVMHARSGGNLEVMGLMLGKVDGETMIIMDSFALPVEGTETRVNAQAAAYEYMAAYIENAKQVGRLENAIGWYHSHPGYGCWLSGIDVSTQMLNQQFQEPFVAVVIDPTRTISAGKVNLGAFRTYPKGYKPPDEGPSEYQTIPLNKIEDFGVHCKQYYALEVTYFKSSLDRKLLELLWNKYWVNTLSSSSLLTNADYTTGQVFDLSEKLEQSEAQLGRGSFMLGLETHDRKSEDKLAKATRDSCKTTIEAIHGLMSQVIKDKLFNQINTA
Donor tissue: gastrula