ORFeome > MGC76072 – XORFeome 2.0

MGC76072 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76072, mRNA (cDNA clone MGC:76072 IMAGE:5307699), complete cds
Gene Symbol: MGC76072
Gene ID: 395042
ORF gb_acc: MG132750
ORF ID: 10053

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064863

Library Location

Plate ID: GDExt11001
Well Location: A09

EST Sequences

Clone: MGC:76072 IMAGE:5307699
Trimmed Sequence: ATGGCGGCGGCAGACGGGGATGATTCTTTATATCCTATCGCTGTGCTCATTGACGAGCTGCGGAATGAAGACGTCCAGCTTCGTCTTAACAGCATTAAAAAGCTCTCAACTATTGCTTTGGCCCTGGGGGTAGAGAGAACACGCAGCGAGCTTCTTCCATTCCTAACCGACACCATATATGATGAAGATGAAGTTCTTCTTGCTTTGGCTGAGCAGCTGGGGACCTTTACTTCACTGGTGGGGGGACCAGAATTTGTACACTGCTTGCTGCCGCCATTGGAGAGCCTGGCAACAGTCGAGGAGACCGTAGTAAGAGACAAAGCCGTTGAATCCCTCCGTGCCATTTCTCACGAGCATTCACCTTCTGACCTTGAAGCTCACTTTGTGCCACTGGTAAAGCGCCTGGCTAGTGGAGACTGGTTCACCTCCCGCACATCTGCCTGTGGCCTCTTCAGCGTTTGCTATCCACGTGTCTCCAGCACTGTAAAGGCCGAACTTAGACAACACTTCCGAAACTTGTGCTCAGACGATACTCCCATGGTGAGAAGAGCCGCTGCTTCCAAGTTGGGGGAGTTTGCTAAAGTTTTGGAGTTGGAAAATGTGAAGAGTGAAATAATTCCCATGTTTTCCAACCTAGCATCTGATGAGCAGGATTCAGTGCGCTTGTTGGCAGTCGAGGCTTGTGTAAACATTGCTCAGCTTCTACCCCAAGAAGAGCTGGAACCACTGGTTATGCCCACACTGCGCCAGGCAGCTGAAGATAAATCTTGGAGAGTAAGATACATGGTGGCAGACAAGTTCACAGAGCTTCAGAAAGCTGTTGGTCCAGAAATCACCAAAACAGACTTGGTTCCTGCTTTCCAAAACCTGATGAAAGACTGTGAAGCCGAAGTACGAGCTGCTGCTTCCCATAAAGTTAAAGAATTCTGTGAGAACCTGTCTGCCGACTGCCGTGAGAATGTAATAATGACGCAGATTCTGCCTTGTGTCAAGGAACTTGTCTCAGATGCCAATCAGCATGTGAAATCTGCCCTGGCTTCAGTCATTATGGGCCTTTCTCCTATTCTCGGCAAAGACAACACCATTGAGCATCTCCTTCCACTTTTCCTTGCACAGCTGAAAGATGAGTGTCCAGAAGTGCGGCTGAATATCATCTCAAACCTGGACTGTGTGAATGAGGTTATTGGGATCAGGCAACTCTCACAGTCACTGCTTCCTGCCATTGTAGAACTGGCAGAAGATGCCAAATGGCGAGTGCGGCTGGCAATTATCGAATACATGCCCCTACTTGCCGGACAGCTGGGAGTGGAGTTCTTTGATGAAAAGTTAAACTCTCTGTGCATGGCCTGGCTGGTGGATCACGTGTATGCCATCCGAGAGGCAGCAACAAGCAACCTGAAGAAGCTGGTGGAGAAGTTTGGCAAAGACTGGGCTCAGGCCACCATTATCCCCAAGGTCCTGGCAATGTCTAACGATCCCAACTACCTACATAGGATGACCACCTTGTTCTGCATCAATGTTCTGTCTGAGGTTTGTGGACAAGAGATCACCACCAAGCATATGCTCCCTACAGTTGTCCGAATGGCCGGGGATGCTGTGGCCAACGTGCGCTTTAATGTGGCAAAGTCTCTGCAGAAAATAGGACCCACCTTGGACAACAGCACGCTACAGAACGAAGTCAAACCAGTGCTGGAGAAGTTAACGCAAGACCAAGACGTAGATGTGAAGTACTTTGCACAGGAAGCACATACAGTGCTGGCTTTGGCGTAA
Full Trace Sequence: gaagaaacaagatggcggcggcagacggggatgattctttatatcctatcgctgtgctcattgacgagctgcggaatgaagacgtccagcttcgtcttaacagcattaaaaagctctcaactattgctttggccctgggggtagagagaacacgcagcgagcttcttccattcctaaccgacaccatatatgatgaagatgaagttcttcttgctttggctgagcagctggggacctttacttcactggtggggggaccagaatttgtacactgcttgctgccgccattggagagcctggcaacagtcgaggagaccgtagtaagagacaaagccgttgaatccctccgtgccatttctcacgagcattcaccttctgaccttgaagctcactttgtgccactggtaaagcgcctggctagtggagactggttcacctcccgcacatctgcctgtggcctcttcagcgtttgctatccacgtgtctccagcactgtaaaggccgaacttagacaacacttccgaaacttgtgctcagacgatactcccatggtgagaagagccgctgcttccaagttgggggagtttgctaaagttttggagttggaaaatgtgaagagtgaaataattcccatgttttccaacctagcatctgatgagcaggattcagtgcgcttgttggcagtcgaggcttgtgtaaacattgctcagcttctaccccaagaagagctggaaccactggttatgcccacactgcgccaggcagctgaagataaatcttggagagtaagatacatggtggcagacaagttcacagagcttcagaaagctgttggtccagaaatcaccaaaacagacttggttcctgctttccaaaacctgatgaaagactgtgaagccgaagtacgagctgctgcttcccataaagttaaagaattctgtgagaacctgtctgccgactgccgtgagaatgtaataatgacgcagattctgccttgtgtcaaggaacttgtctcagatgccaatcagcatgtgaaatctgccctggcttcagtcattatgggcctttctcctattctcggcaaagacaacaccattgagcatctccttccacttttccttgcacagctgaaagatgagtgtccagaagtgcggctgaatatcatctcaaacctggactgtgtgaatgaggttattgggatcaggcaactctcacagtcactgcttcctgccattgtagaactggcagaagatgccaaatggcgagtgcggctggcaattatcgaatacatgcccctacttgccggacagctgggagtggagttctttgatgaaaagttaaactctctgtgcatggcctggctggtggatcacgtgtatgccatccgagaggcagcaacaagcaacctgaagaagctggtggagaagtttggcaaagactgggctcaggccaccattatccccaaggtcctggcaatgtctaacgatcccaactacctacataggatgaccaccttgttctgcatcaatgttctgtctgaggtttgtggacaagagatcaccaccaagcatatgctccctacagttgtccgaatggccggggatgctgtggccaacgtgcgctttaatgtggcaaagtctctgcagaaaataggacccaccttggacaacagcacgctacagaacgaagtcaaaccagtgctggagaagttaacgcaagaccaagacgtagatgtgaagtactttgcacaggaagcacatacagtgctggctttggcgtaagggcggccattaacagacgctcgccatgaagcgtctccctgcacgattcctgctcgtgtttcggaaatccatctcccgactctcagtggtgtctcgtttcctctcatcacacagccttctagatcgctccctctctccctcttcaccgctgaacttaattataaataaattgttaactggctgtggcttttaaccccaacatgctgtttttatgtcccagggacatgattgagggggggtggggggcttcatacgtttgcagggctgctttgtttataccctacaaaagaacctggcagctttctatgtgcgtggaaacaagtaatgaatccatacatatattcctgtattatgcactcgagctgatgtaagtacgttgaaattgcctcttactatacacgtcgacttttaaagttgtttttattttctgtttttttgtttttacccaataaaaacactaaatatttccgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAADGDDSLYPIAVLIDELRNEDVQLRLNSIKKLSTIALALGVERTRSELLPFLTDTIYDEDEVLLALAEQLGTFTSLVGGPEFVHCLLPPLESLATVEETVVRDKAVESLRAISHEHSPSDLEAHFVPLVKRLASGDWFTSRTSACGLFSVCYPRVSSTVKAELRQHFRNLCSDDTPMVRRAAASKLGEFAKVLELENVKSEIIPMFSNLASDEQDSVRLLAVEACVNIAQLLPQEELEPLVMPTLRQAAEDKSWRVRYMVADKFTELQKAVGPEITKTDLVPAFQNLMKDCEAEVRAAASHKVKEFCENLSADCRENVIMTQILPCVKELVSDANQHVKSALASVIMGLSPILGKDNTIEHLLPLFLAQLKDECPEVRLNIISNLDCVNEVIGIRQLSQSLLPAIVELAEDAKWRVRLAIIEYMPLLAGQLGVEFFDEKLNSLCMAWLVDHVYAIREAATSNLKKLVEKFGKDWAQATIIPKVLAMSNDPNYLHRMTTLFCINVLSEVCGQEITTKHMLPTVVRMAGDAVANVRFNVAKSLQKIGPTLDNSTLQNEVKPVLEKLTQDQDVDVKYFAQEAHTVLALA
Donor tissue: gastrula