ORFeome > MGC76082 – XORFeome 2.0

MGC76082 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76082, mRNA (cDNA clone MGC:76082 IMAGE:5307948), complete cds
Gene Symbol: MGC76082
Gene ID: 394681
ORF gb_acc: MG132758
ORF ID: 10062

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062503

Library Location

Plate ID: GDExt11001
Well Location: D06

EST Sequences

Clone: MGC:76082 IMAGE:5307948
Trimmed Sequence: ATGGCATCCCTGAGCCTGGGATTAAGTCTGTCTAGGAAGAAGAATGCCTTGAGGAATGCAGCAGTGGAGAGGAAGAATCTGCTCACAGTCTGCAGGCTTTCTGTGAAGACATTAATTGACCGTTCCTGCTTTGAGACAATTGATGACTCTGCACCAGAATTTGTTAATTTTGCCTCTATACTGGAACAGATCCTAAGCCATCGCCTTAAAGGTCAGGTTACCTGGTTTGGATATGAAAGTCCTCGAAGCTTTTGGGATTACATACGGGTTGCCTGCTCCAAAGTGTCTCACAGTTGCATCTGTAGCATTGAAAATATGGAAAATGTCAGTTCATCCAGAGCTAAGGGCAGAGCGTGGATCAGAGTTGCACTGATGGAAAAACGCCTTTCTGAATATATTACAGCAGCACTGAGGGATTACAAAACCACAAGGAGGTTTTATGATGATGGCGCTATTGTCTTGGGCGAGGAAGCGAATATGCTCGCTGGCATGCTGCTCGGACTCAATGCAATTGACTTCAGCTTCTGCCTTAAAGGGGAGGGATTGGATGGGACCCACCCAGCTGTAATTGACTATACGCCTTATCTGAAATTTACACAAAGCTCTGATAGCATCAGCAGTGATGAAGAGGAGCTCCGGACTCTGGGAAGCAGTGGCAGTGAGAGCAGCACTCCTGAGAACATTGGCCCTCCTTTTATCATGGATGAAAACAGCTGGTACAACAAATGCAAGAAAGTAGAGCAAAAGTATCGGCTAGCACTGGAACAAAAGGGTTACTTGGAGGAGCTGGTGCGACTGAGAGAAGCTCAATTTACAGAATCAGTGTCACAGAACAAGCTGCTACTTCAGAGAATCGAAGATATAGAGTTAAATCACAAGCTGGAGAAGGAACAACTTGAATATATCATTGTAGAGCTGCAGGATCAGCTGTGA
Full Trace Sequence: ctattggcagaactgcaggcaccctaaataatcctcagcccagcactgtgatgccggtgcctgccattccctgatctcctgccatctagctgggctttgtgctccctagcagcctgcctggctcatgtgctgggctgcctgggacctggtgagatcagcctatagtcaggcagtgtcagtgagaggcactgggggaggtgcagcactagcccatcattactaggctgctgctgctgctgaatggcaggggggccacttccataggcagggcaatacctccacatacacaaagaagcactgggggtgtccaggctggagatggcatccctgagcctgggattaagtctgtctaggaagaagaatgccttgaggaatgcagcagtggagaggaagaatctgctcacagtctgcaggctttctgtgaagacattaattgaccgttcctgctttgagacaattgatgactctgcaccagaatttgttaattttgcctctatactggaacagatcctaagccatcgccttaaaggtcaggttacctggtttggatatgaaagtcctcgaagcttttgggattacatacgggttgcctgctccaaagtgtctcacagttgcatctgtagcattgaaaatatggaaaatgtcagttcatccagagctaagggcagagcgtggatcagagttgcactgatggaaaaacgcctttctgaatatattacagcagcactgagggattacaaaaccacaaggaggttttatgatgatggcgctattgtcttgggcgaggaagcgaatatgctcgctggcatgctgctcggactcaatgcaattgacttcagcttctgccttaaaggggagggattggatgggacccacccagctgtaattgactatacgccttatctgaaatttacacaaagctctgatagcatcagcagtgatgaagaggagctccggactctgggaagcagtggcagtgagagcagcactcctgagaacattggccctccttttatcatggatgaaaacagctggtacaacaaatgcaagaaagtagagcaaaagtatcggctagcactggaacaaaagggttacttggaggagctggtgcgactgagagaagctcaatttacagaatcagtgtcacagaacaagctgctacttcagagaatcgaagatatagagttaaatcacaagctggagaaggaacaacttgaatatatcattgtagagctgcaggatcagctgtgagtaccacacgagacttcgttcactgctgaaggcaggtgctttaatggtcacattttctgcactggaaagaaactgctctaataatgagaaattatgcgttatagtatagccataatgtgggatgttaagcttggaggtcatttgtgtgcgtcaggggtcatggtagaagctccttaaaggacaatgaaacgtatgaaaataacaaataaagctctcattactgaaaaaaagagaactattaaagcgaaataaaaagaaagaaaaaaaaaaaaaaaaaaaa
Translation: MASLSLGLSLSRKKNALRNAAVERKNLLTVCRLSVKTLIDRSCFETIDDSAPEFVNFASILEQILSHRLKGQVTWFGYESPRSFWDYIRVACSKVSHSCICSIENMENVSSSRAKGRAWIRVALMEKRLSEYITAALRDYKTTRRFYDDGAIVLGEEANMLAGMLLGLNAIDFSFCLKGEGLDGTHPAVIDYTPYLKFTQSSDSISSDEEELRTLGSSGSESSTPENIGPPFIMDENSWYNKCKKVEQKYRLALEQKGYLEELVRLREAQFTESVSQNKLLLQRIEDIELNHKLEKEQLEYIIVELQDQL
Donor tissue: gastrula