ORFeome > MGC76093 – XORFeome 2.0

MGC76093 – XORFeome 2.0

General Information

Species: Xenopus tropicalis diacetyl/L-xylulose reductase, mRNA (cDNA clone MGC:76093 IMAGE:5308230), complete cds
Gene Symbol: MGC76093
Gene ID: 394704
ORF gb_acc: MG132709
ORF ID: 10001

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062504

Library Location

Plate ID: GDExt11001
Well Location: H04

EST Sequences

Clone: MGC:76093 IMAGE:5308230
Trimmed Sequence: ATGGAGATAAACTTCTGTGGCCAACGGGCCTTGGTGACTGGGGCAGGGAAGGGCATTGGACGGGAGACTGTAAAGGCTTTGAGGAAAACAGGGGCAGAAGTGGTTGCTCTGAGTAGAACTTTTGAAGACCTGGAAAGCTTGGCCCAAGAGTGCCCTGGAGTGCAGACAGTATGCGTGGATTTGGCAGACTGGTCAGCGACAGAAAAAGCTCTAAGCTCCATTGGACCTGTGGACCTACTGGTAAACAATGCCGCTGTGGCAGTCCTACAGCCATTTCTTGCAGTCACAGAAGAAGCATTTGACAAGAGCTTTGCTGTGAATGTTAAAGCAGTGTTACACGTCTCACAGATTGTTGTCCATCAGATGATTGAGCGTGGAGTTCCTGGTGCCATCGTTAATGTATCCAGCCAGGCCTCTCAGTGTGCATTACAGGACCACTCTGTGTACTGTGCAACAAAAGGAGCTTTAGACATGCTGACTAAGGTGATGACACTTGAACTAGGTCCAAAAAAGATTCGTGTTAACTCCGTAAACCCTACTGTAGTAATGACCGAGATGGGACGCATTGGTTGGAGTGATCCCCAGAAGTCTGAGCCAATGTTAAAGCGTATTCCTATGGGACGCTTTGCTGAAGTGGAAGACGTAGTTCACAGCATTCTGTTCCTGCTCAGTGATAAGAGTTCCATGATTACTGGCTCATGTCTGCCTGTGGATGGGGGATTCCTTGCCTGTTGA
Full Trace Sequence: gccctgtgctattatggagataaacttctgtggccaacgggccttggtgactggggcagggaagggcattggacgggagactgtaaaggctttgaggaaaacaggggcagaagtggttgctctgagtagaacttttgaagacctggaaagcttggcccaagagtgccctggagtgcagacagtatgcgtggatttggcagactggtcagcgacagaaaaagctctaagctccattggacctgtggacctactggtaaacaatgccgctgtggcagtcctacagccatttcttgcagtcacagaagaagcatttgacaagagctttgctgtgaatgttaaagcagtgttacacgtctcacagattgttgtccatcagatgattgagcgtggagttcctggtgccatcgttaatgtatccagccaggcctctcagtgtgcattacaggaccactctgtgtactgtgcaacaaaaggagctttagacatgctgactaaggtgatgacacttgaactaggtccaaaaaagattcgtgttaactccgtaaaccctactgtagtaatgaccgagatgggacgcattggttggagtgatccccagaagtctgagccaatgttaaagcgtattcctatgggacgctttgctgaagtggaagacgtagttcacagcattctgttcctgctcagtgataagagttccatgattactggctcatgtctgcctgtggatgggggattccttgcctgttgattctttaagccaatattctctgcaccactgtgggccaatccatatctctccaactatttctgaacaacagtgccagcatatttgaccatagataaaccagcactggtctaaatgatttctggaccttgtaatcttaaaaataaaaaaaaatctatgcatttaagtgcagaagaaccataagaacttcacaactttccattacaggtgtggagcctgttattcagaatgctccagaatgggaccttggtttaccagataaagggtctttctgtaatttgagtaaccatgctactaaaaaaatactttaaacattaaataaacccaatagaattgttctgcctacaataaagattaagtacacagtattggtttatcattacagagaaaaaagtaatcatttttcaaaacgggaatcaagtaattgaagtcaatggggtatggccttcccgtaatttggagctttctggataatagatcctttacatgtgttaccttttataagcaatgatacattttgttatattctgtctgaaataaataaatatctgatcctacaaaaaaaaaaaaaaaaaaa
Translation: MEINFCGQRALVTGAGKGIGRETVKALRKTGAEVVALSRTFEDLESLAQECPGVQTVCVDLADWSATEKALSSIGPVDLLVNNAAVAVLQPFLAVTEEAFDKSFAVNVKAVLHVSQIVVHQMIERGVPGAIVNVSSQASQCALQDHSVYCATKGALDMLTKVMTLELGPKKIRVNSVNPTVVMTEMGRIGWSDPQKSEPMLKRIPMGRFAEVEDVVHSILFLLSDKSSMITGSCLPVDGGFLAC
Donor tissue: gastrula