ORFeome > MGC76116 – XORFeome 2.0

MGC76116 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76116, mRNA (cDNA clone MGC:76116 IMAGE:5308861), complete cds
Gene Symbol: MGC76116
Gene ID: 394943
ORF gb_acc: MG132741
ORF ID: 10042

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064214

Library Location

Plate ID: GDExt11001
Well Location: H09

EST Sequences

Clone: MGC:76116 IMAGE:5308861
Trimmed Sequence: ATGGAAGAAGATGAAGTCGCGGAGAGTTGGGAAGAAGCGGCCGATAGCGGAGAAATAGACAGACGGCTGGAGAAGAAGCTGAAGATCTCTCAGAGGGAAAACAGCAAGTCGAAGTCGCCTCCCAAAGCCCCCGTGGTTATCCAGGACGACTCCCTTCCATCCGGCCCCCCTCCGCAGATCAGAATCCTGAAACGGCCAACGTCCAACGGCTTGGCCAGTAACCCGAACGCCTGCAGCCGGCCCGCCGCGCCAGTCAAGTCATTGGCACAGAGAGAGGCGGAATACGCAGAAGCCAGAAAGCGCATCTTGGGCAGCGCCAGCCCAGAGGAGGAGCAGGAGAAGCCGGTTGCGGACAGACCCGCACGGATCAATCAGGCGGAAGAGATCCGGCAGCCGAACAATGTGATCCGGCAGCCGCTGGGCCCCGACGGTTCCCAAGGCTTCAGACAGCGCAGATAA
Full Trace Sequence: ggaagatggaagaagatgaagtcgcggagagttgggaagaagcggccgatagcggagaaatagacagacggctggagaagaagctgaagatctctcagagggaaaacagcaagtcgaagtcgcctcccaaagcccccgtggttatccaggacgactcccttccatccggcccccctccgcagatcagaatcctgaaacggccaacgtccaacggcttggccagtaacccgaacgcctgcagccggcccgccgcgccagtcaagtcattggcacagagagaggcggaatacgcagaagccagaaagcgcatcttgggcagcgccagcccagaggaggagcaggagaagccggttgcggacagacccgcacggatcaatcaggcggaagagatccggcagccgaacaatgtgatccggcagccgctgggccccgacggttcccaaggcttcagacagcgcagataaagatgaaggagcgaagccgcaccgggttgcactgccctgtcacaacaatggatctgagcagagggaacgactttgttttcttgcactttgacgccctttttgctccgcccactgtgaccttaaaacctgcgcactgtgaccccctcctgccacccctgtagctctgaccactgtgattggcacattgcctcgggctaccccagttccaccaagggcaagcatgactgcatgtgccgcgtgggcggggcttcgtaacgagaccgcccccgagtgtaaagggagcaaagggggtgccacgtgcctctgactgccacttctgtcgaagtcaccgccagcaataatgttcataatcattctgtctccggaggggagtggctgccccccaccctttattacatagctattgtccttaggaatgcatgccaagcgtcggtagcgggcagagggggcccctagtccgggggccacacagagcgtgcatgggaaggctcattttaatcaagacagattcgttttaacagagtttatattggtgtaaagggcaagcggggaggttttattgtctatggattcgtgggcagagccccctccggcaatggggtctgtagtggacagttctggtgcttggccaatcaggtgtgttcaagttggtaagggcattgagcttgttaaattaaccccttggtgtgcgggatggggcgggatgcatgtgctgctattgagcatggcttcagaatcaggatggctgagcggctcaggaactgcccctcagtgatgggggggggaagaggtatttctgccggtcggtaccggtaccggctcgggatccgaggagtcggccagaaggctggcatctcaaggcctgggctgtccccagagtacaaagatgtggaatgtgtagacgcctggcattcttctgccccagtgctgggcattaccggcccctgctgcagccgtgattgggcagtcatggggagggaggggggtgctgggcattaccggcccctgctgcagccgtgattgggcagtcatggggagggaggggggtgctgggcattaccggcccctgctgcagccgtgattgggcagtcatggggagggaggggggtgctgggcattaccggcccctgctgcagccgtataaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEEDEVAESWEEAADSGEIDRRLEKKLKISQRENSKSKSPPKAPVVIQDDSLPSGPPPQIRILKRPTSNGLASNPNACSRPAAPVKSLAQREAEYAEARKRILGSASPEEEQEKPVADRPARINQAEEIRQPNNVIRQPLGPDGSQGFRQRR
Donor tissue: gastrula