ORFeome > MGC76145 – XORFeome 2.0

MGC76145 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76145, mRNA (cDNA clone MGC:76145 IMAGE:5335239), complete cds
Gene Symbol: MGC76145
Gene ID: 394517
ORF gb_acc: MG132720
ORF ID: 10015

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061610

Library Location

Plate ID: GDExt11001
Well Location: H06

EST Sequences

Clone: MGC:76145 IMAGE:5335239
Trimmed Sequence: ATGTCGCTTATTCACGAGATCCTGGGCAAGCTGTCCTTGGAAGGAAATCAATCAAGCACAAGACAGTCGACATTAGGTTCAGTCAAAGCAAGCTCAAACTTTGATGCAGAAAGGGATGCAGCAGCCATCGAAACTGCCATTAAGACTAAAGGTGTGGATGAGTTGACAATCATCAACATTCTAACAAACCGCAGTAATGAACAGAGACAAGACATAGCATTTGCCTACCACAGGAAAACAAAGAAGGACCTGCCATCTGCATTAAAGGGAGCTCTCTCTGGCAATCTGGAAACTTTTATGTTGGGGCTAATTAAGACTCCACCTCAGTATGATGCTTCAGAACTGAAGGCTTCAATGAAGGGGCTGGGCACCGATGAAGATAGCTTAATTGAGATCATCTGCTCCCGGACCAATAAAGAGTTGCTGAATATTCAGAATGCATACAGAGAATTATTCAAGACAGAACTGGAAAAAGACATTGTGTCCGACACCTCTGGTGATTTCCGCAAATTAATGGTGGCTCTTGCTAAGGGAAAACGCCAGGAAGAATGTAATGTGGTAGATTATGAGAAGATTGACCAAGATGCCAGGGAGCTGTATGAAGCTGGAGTGAAGAGGAAAGGAACAGATGTGAACAAATGGATCTCAATAATGACAGAAAGAAGCATCCCCCACCTTCAGAAAGTATTTGAAAGATACAAGAGCTACAGCCCATACGACATGGAAGAGAGCATTAAGAAAGAAGTGAAAGGAGATCTGGAGAATGCCTTTTTGAATCTAGTTCAGTGCATCCAGAACAAACCCCTGTATTTTGCAGACAGATTGTATGATTCAATGAAGGGCAGAGGCACCAAAGACAAAATCTTGATCCGAATTATGATTTCACGAAGTGAATCGGACATGCTGAAAATCAGATCAGAGTTTAAGAAGAAATATGGCAAATCGTTACATTACTTCATTGGGCAAGACACAAAAGGTGATTACCAGCGTGCCCTCCTTAACCTCTGTGGAGGAGATGACTAA
Full Trace Sequence: cggacagtagcgccttgttcttctcctgctgcgcaagtacagctgccgtaccaatgtcgcttattcacgagatcctgggcaagctgtccttggaaggaaatcaatcaagcacaagacagtcgacattaggttcagtcaaagcaagctcaaactttgatgcagaaagggatgcagcagccatcgaaactgccattaagactaaaggtgtggatgagttgacaatcatcaacattctaacaaaccgcagtaatgaacagagacaagacatagcatttgcctaccacaggaaaacaaagaaggacctgccatctgcattaaagggagctctctctggcaatctggaaacttttatgttggggctaattaagactccacctcagtatgatgcttcagaactgaaggcttcaatgaaggggctgggcaccgatgaagatagcttaattgagatcatctgctcccggaccaataaagagttgctgaatattcagaatgcatacagagaattattcaagacagaactggaaaaagacattgtgtccgacacctctggtgatttccgcaaattaatggtggctcttgctaagggaaaacgccaggaagaatgtaatgtggtagattatgagaagattgaccaagatgccagggagctgtatgaagctggagtgaagaggaaaggaacagatgtgaacaaatggatctcaataatgacagaaagaagcatcccccaccttcagaaagtatttgaaagatacaagagctacagcccatacgacatggaagagagcattaagaaagaagtgaaaggagatctggagaatgcctttttgaatctagttcagtgcatccagaacaaacccctgtattttgcagacagattgtatgattcaatgaagggcagaggcaccaaagacaaaatcttgatccgaattatgatttcacgaagtgaatcggacatgctgaaaatcagatcagagtttaagaagaaatatggcaaatcgttacattacttcattgggcaagacacaaaaggtgattaccagcgtgccctccttaacctctgtggaggagatgactaaatttccaataaaactggatctgttctccccttcactgcttgcctgtggtctgcaaagtgatccagccaattgtacgtctgtactgctacattcccgtttccttgccaataaaactactccatattttaaaaaaaaaaaaaaa
Translation: MSLIHEILGKLSLEGNQSSTRQSTLGSVKASSNFDAERDAAAIETAIKTKGVDELTIINILTNRSNEQRQDIAFAYHRKTKKDLPSALKGALSGNLETFMLGLIKTPPQYDASELKASMKGLGTDEDSLIEIICSRTNKELLNIQNAYRELFKTELEKDIVSDTSGDFRKLMVALAKGKRQEECNVVDYEKIDQDARELYEAGVKRKGTDVNKWISIMTERSIPHLQKVFERYKSYSPYDMEESIKKEVKGDLENAFLNLVQCIQNKPLYFADRLYDSMKGRGTKDKILIRIMISRSESDMLKIRSEFKKKYGKSLHYFIGQDTKGDYQRALLNLCGGDD
Donor tissue: tailbud