ORFeome > MGC76148 – XORFeome 2.0

MGC76148 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76148, mRNA (cDNA clone MGC:76148 IMAGE:5335265), complete cds
Gene Symbol: MGC76148
Gene ID: 395019
ORF gb_acc:
ORF ID: 10020

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064868

Library Location

Plate ID: GDExt11001
Well Location: F11

EST Sequences

Clone: MGC:76148 IMAGE:5335265
Trimmed Sequence: ATGCTGCGCTTACAGCTGACCGATGGCCATACTAGTTGTACAGCAATAGAACTTAATTACTTGTCAAAAATAAGTCTGAACACTCCACCTGGCACAAAAATAAAGCTATTAGGAACTATTGAAGTGAAAAATGGATACTTGCTTTTGGATGACACCAACACTGTCGTTCTTGGAGGTGAAGTGGAACATCTCATAGAGAAGTGGGAGCTGCAGAGGAGTTTATCAAAGCACAGTAGAAGCAATATTGGAATAGAAGGAGGACCCCCACCATTTGTGCCTTTTGGACAGCGATGTGCATCAGTTGCTTCAGTAGACAGCAAAGAACTTGATAGCCGAAAAACTCTGCAAGCTTCCAGTGTGACGAAACCTGTTGGGGAGAATGATGAATTTGAAAAGCAAAGAACTGCTGCTATAGCTGAAGTTGCTAAAAGCAAAGAGACAAAGACGTTCGGAGGAGGTGGTAATGCTGGAAGTAATCTCAATCCAGGTGCTGGAGGGAGCCGTAACAAGGAAGTGTTCCAAAAAGAGAAGATAATCAGAGCTGAAGGGAAATCAGAAGGAGTATATCGCGAACTGGTAGATGAAAAGGCACTGAGACACATCACAGAAATGGGATTTAGTAAGGATGCAGCCAGGCAGGCACTTATGGACCACAGCAACAATGTGGAAGCTGCCTTAAATTCCCTCTTGACAGGCAACAAATCCAAACCAGTTCAAGGACCACCAGCCAGAGGAAAGGGAAAAGGCAGAGGGAGAACACGTGCTGAAGAAGATGATGAATTAACTAGTGCCAGGCCTTCAGCACCAAGTACTCTGTTTGACTTTCTGGAGTCCAAGATGGGAAGCTTTTCTATTGAAGATCATAAACTACAGAGTCAATCTCAGAGCCAGGTTCATCAGAAACCTCTGAATTTAGAACAGAATGGTATTAAGGACTACAACCATAAGGACTACAACCAACCACGCCAATTTACTCGAAATGATACTAGAGCTCCTAGGAATGAGAAGCCCCCACGATTTCAGAAGGAAATTCAAGCTTCTCGGCAATATGAAGGCAATGGGCCTCCAAAAAGCAGAGGTTCTGAAAAACAGAGCTCATCAGTAGCTGAGCAGTGGATGGAGGAAAGAAATAAATGTGAAAGAGGATATCCAAGAAATGATAGACTAAAGGATTTTTCCCACCTTCCCTCTAGCCACCAAAATGAGGGTTCATATAAAAAATCCTACACTAATCCTATGCAAGGCAGAGGTATGAAGGGAGGCAACCACACAGAAGTGAAAGAGGAGTTCCACCATCAAAATAGCAATACTGAGGGTTCACATCAAAAACGTGGTAAAAAAGATGACCAAAGATATAATTCTGAATTTTATACTGACAGGAGAGCACGGACAGGAAACACTGAAACATTTACCAATATACCAAATGAAAAATGTTTTAGTGCCAATAATGAACTATCTAATTTTCAAACCATATTGATTAAAGATGGTGCTAATGACTTATCAAATGGAGAGGTTGACCAGAAAGCAAGACGATTTGGACCTATAAAACCCATTGGAACAAATCTGAATTCATCACACGAAGACAAAAGCAAGATGTTTTCTTACAACAATGCAAAAAAAAGGTCTGGTCCTATAAAACAAGAAAGACCACTGGAAGCAGTCTATTCTGGATTTAGCTGGAGACCAGGTGATGAATGTTTGGCTCTTTACTGGGAAGACAATAAGTATTACAGAGCTGAGGTAGAAGCCCTTCATTCTTCTGGAACAACTGCTGTAGTAAAATTTAGTGACTATGGAAATTATGAAGAAGTGCTACTGGAAAACATCCGGCCTATCCAGGCAGAAGCATGGGAAGAAGAAGGGGATTTTGGGGACTTTCGTAGAGGAGGTGATGGCCAACCAAGAAGATCGACTAGACCAACACAGCAATTTTATCAACCACCCAGAGCACGGAACTGA
Full Trace Sequence: caaaagtaccgatctctgcattcttgccccagaaacagcggcacagtgcctttctgagaatgggttggaagcatgcaaatattcaacagagaacagaacgatgttgcttatagctctcaatacagatctgagaaccactgggaagaaatttctcccaaatgacattaacggaggcaaagtagagaaggttaatggaccatgtgttcttcaaattcagaaaattcgcaatatttctgcaccaaaagacaatgaagagtctcaggctgctccccggatgctgcgcttacagctgaccgatggccatactagttgtacagcaatagaacttaattacttgtcaaaaataagtctgaacactccacctggcacaaaaataaagctattaggaactattgaagtgaaaaatggatacttgcttttggatgacaccaacactgtcgttcttggaggtgaagtggaacatctcatagagaagtgggagctgcagaggagtttatcaaagcacagtagaagcaatattggaatagaaggaggacccccaccatttgtgccttttggacagcgatgtgcatcagttgcttcagtagacagcaaagaacttgatagccgaaaaactctgcaagcttccagtgtgacgaaacctgttggggagaatgatgaatttgaaaagcaaagaactgctgctatagctgaagttgctaaaagcaaagagacaaagacgttcggaggaggtggtaatgctggaagtaatctcaatccaggtgctggagggagccgtaacaaggaagtgttccaaaaagagaagataatcagagctgaagggaaatcagaaggagtatatcgcgaactggtagatgaaaaggcactgagacacatcacagaaatgggatttagtaaggatgcagccaggcaggcacttatggaccacagcaacaatgtggaagctgccttaaattccctcttgacaggcaacaaatccaaaccagttcaaggaccaccagccagaggaaagggaaaaggcagagggagaacacgtgctgaagaagatgatgaattaactagtgccaggccttcagcaccaagtactctgtttgactttctggagtccaagatgggaagcttttctattgaagatcataaactacagagtcaatctcagagccaggttcatcagaaacctctgaatttagaacagaatggtattaaggactacaaccataaggactacaaccaaccacgccaatttactcgaaatgatactagagctcctaggaatgagaagcccccacgatttcagaaggaaattcaagcttctcggcaatatgaaggcaatgggcctccaaaaagcagaggttctgaaaaacagagctcatcagtagctgagcagtggatggaggaaagaaataaatgtgaaagaggatatccaagaaatgatagactaaaggatttttcccaccttccctctagccaccaaaatgagggttcatataaaaaatcctacactaatcctatgcaaggcagaggtatgaagggaggcaaccacacagaagtgaaagaggagttccaccatcaaaatagcaatactgagggttcacatcaaaaacgtggtaaaaaagatgaccaaagatataattctgaattttatactgacaggagagcacggacaggaaacactgaaacatttaccaatataccaaatgaaaaatgttttagtgccaataatgaactatctaattttcaaaccatattgattaaagatggtgctaatgacttatcaaatggagaggttgaccagaaagcaagacgatttggacctataaaacccattggaacaaatctgaattcatcacacgaagacaaaagcaagatgttttcttacaacaatgcaaaaaaaaggtctggtcctataaaacaagaaagaccactggaagcagtctattctggatttagctggagaccaggtgatgaatgtttggctctttactgggaagacaataagtattacagagctgaggtagaagcccttcattcttctggaacaactgctgtagtaaaatttagtgactatggaaattatgaagaagtgctactggaaaacatccggcctatccaggcagaagcatgggaagaagaaggggattttggggactttcgtagaggaggtgatggccaaccaagaagatcgactagaccaacacagcaattttatcaaccacccagagcacggaactgactgttaagatcaaccctgaagttggcaaagaagaaagaaacagtgcagatgttgggaaagtagctgtatatttttctaaagaatcagattgcgctgtggcattaacttggattggagagcagcaaactggaagtgctgagcttgagagaagtagctaagcatttgtcatcatttgctaattaaattcatttctaaaagatttgagggtttttttttttttttttttgcatcaataaaaccccagtgcactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaccaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLRLQLTDGHTSCTAIELNYLSKISLNTPPGTKIKLLGTIEVKNGYLLLDDTNTVVLGGEVEHLIEKWELQRSLSKHSRSNIGIEGGPPPFVPFGQRCASVASVDSKELDSRKTLQASSVTKPVGENDEFEKQRTAAIAEVAKSKETKTFGGGGNAGSNLNPGAGGSRNKEVFQKEKIIRAEGKSEGVYRELVDEKALRHITEMGFSKDAARQALMDHSNNVEAALNSLLTGNKSKPVQGPPARGKGKGRGRTRAEEDDELTSARPSAPSTLFDFLESKMGSFSIEDHKLQSQSQSQVHQKPLNLEQNGIKDYNHKDYNQPRQFTRNDTRAPRNEKPPRFQKEIQASRQYEGNGPPKSRGSEKQSSSVAEQWMEERNKCERGYPRNDRLKDFSHLPSSHQNEGSYKKSYTNPMQGRGMKGGNHTEVKEEFHHQNSNTEGSHQKRGKKDDQRYNSEFYTDRRARTGNTETFTNIPNEKCFSANNELSNFQTILIKDGANDLSNGEVDQKARRFGPIKPIGTNLNSSHEDKSKMFSYNNAKKRSGPIKQERPLEAVYSGFSWRPGDECLALYWEDNKYYRAEVEALHSSGTTAVVKFSDYGNYEEVLLENIRPIQAEAWEEEGDFGDFRRGGDGQPRRSTRPTQQFYQPPRARN
Donor tissue: tailbud