ORFeome > MGC76235 – XORFeome 2.0

MGC76235 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76235, mRNA (cDNA clone MGC:76235 IMAGE:5336615), complete cds
Gene Symbol: MGC76235
Gene ID: 394516
ORF gb_acc: MG132793
ORF ID: 10121

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061620

Library Location

Plate ID: GDExt11002
Well Location: G02

EST Sequences

Clone: MGC:76235 IMAGE:5336615
Trimmed Sequence: ATGTCCAGCCTGCAGAGATCGGCCCCTGCCTCACAGAATGTGTCCCTGCCCCTGGAGCAGGTTAAGGAGGCTCTAGGGGAAGTGCTGAACGCTCTGCAGTCGCCTACGGGAAGTGCCCGGCTGGAAGAGGCAAGAGAGAATTCCGGGAATGACCTCGGGAAAGTCCTGCAGCTTCTTCTCCCGGCAGCTGTTCAGATCCAGCAGGAAGTTCTGCAGAATTACGGATTTAGTCCTGATGGTGAGGGTGTCCTCAGATTTGCCAGACTTGTCAAGTCTTATGAATCACAGGACCCTGAAATTGCCGCTATGTCCAGCAAACTGAAGTCCTTCTTCCTGCCGCCGTTACCGCTTCCCCCCCACGCTGGTCTCTCCGCCCCTTCATCATGA
Full Trace Sequence: cgggtatagacatgtccagcctgcagagatcggcccctgcctcacagaatgtgtccctgcccctggagcaggttaaggaggctctaggggaagtgctgaacgctctgcagtcgcctacgggaagtgcccggctggaagaggcaagagagaattccgggaatgacctcgggaaagtcctgcagcttcttctcccggcagctgttcagatccagcaggaagttctgcagaattacggatttagtcctgatggtgagggtgtcctcagatttgccagacttgtcaagtcttatgaatcacaggaccctgaaattgccgctatgtccagcaaactgaagtccttcttcctgccgccgttaccgcttcccccccacgctggtctctccgccccttcatcatgaactgttccacttcttgttgcgaaatagcaggctatgcctgaaacatccatcactcctccctttggctgttacacacttggcccctcattaatggacagttggattggaattaaggaatctttttctgtctgttactttaacatttcaggctccagttctccctcagagggaatcattttgtcccactctgtctggtatcggtggtactttctgcggcggcatatgagatacataacaagttagttatactagaaaatactcagagggaggatgggcctgtattgatctgtctcttgtattgctctgtatagaggggagtttgtgaaaaatagaggcagaaaacatttttggccccagaccttaagccaggactgtctggaagcccaagttttagatgtggccctcagagtaatggctatagcccccagcctggccattggctagataaacttatttctatgacataatcagggctaagaacatttggcatattaaatatgcaggcagggtgctgtcttctgtaggaagttttcctcccaaagcgtatcattctaaccaggggttagaaaaggtccaaaatggagcctgtgccagatacagtcagtaagctttgttgtggggtggttgaaaacagtggcataactatggttctttggtctctagttacaccactggctaaaaaaaataaaagtaatttgaaataaaaaaaaaaaaaaaaa
Translation: MSSLQRSAPASQNVSLPLEQVKEALGEVLNALQSPTGSARLEEARENSGNDLGKVLQLLLPAAVQIQQEVLQNYGFSPDGEGVLRFARLVKSYESQDPEIAAMSSKLKSFFLPPLPLPPHAGLSAPSS
Donor tissue: tailbud