ORFeome > MGC76254 – XORFeome 2.0

MGC76254 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76254, mRNA (cDNA clone MGC:76254 IMAGE:5379047), complete cds
Gene Symbol: MGC76254
Gene ID: 395024
ORF gb_acc: MG132765
ORF ID: 10069

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064880

Library Location

Plate ID: GDExt11001
Well Location: B12

EST Sequences

Clone: MGC:76254 IMAGE:5379047
Trimmed Sequence: ATGCCTCTTAATGCCAATTTCCCCAGCAAGAACTACGACTACGACTATGACTTGCAGCCCTGCTTCTTCTTTCTGGAGGAGGAGAACTTCTACCACCAGCAAAGCCGACTGCAGCCGCCGGCCCCCAGTGAGGACATCTGGAAGAAGTTTGAGCTGCTCCCCACCCCACCCCTGTCACCCAGCCGCAGATCCAGCCAGTCCAGCCTTTTCCCCTCTACGGCTGATCAGCTGGAGATGGTGACCGAATTCCTGGGAGGGGACATGGTCAACCAGAGCTTTATCTGCGAGGCGGACGATGAAGCCTTGCTGAAGTCTATCGTCATACAGGACTGTATGTGGAGCGGCTTCTCGGCGGCAGCCAAGCTTGAGAAAGTGGTATCTGAGAAGCTGGCATCCTACCAGGCTTCTAGGAAAGAGAGTGCTCTGTCTTCTTCTCAGTGCCAGAGTCCACCAGAGCAGAGCCCACTTAAGTCTCCTTCATGCCATGGGAGCCTCAGTCTCGGAGGGACTCGGAGCAGCCATGGATTCCTCCAGGACCCCAGCTCGGATTGTGTTGACCCTTCGGTGGTTTTCCCATACCCTCTGAATGACAGCATTTCCAACGCCAGCTCACCTTGCCAAGACCTCATGTTGGAAACGCCACCGATCAGCAGCAACAGCAGCAGCAGTGAATCAGAAGAGGAACCGGAAGACGAGGATGAAGACTGTGATGAGGAAGAAGAGATTGATGTTGTCACGGTGGAAAAAAGGCAGACGGCATCCAAGCGAATGGAATCCAGCTCTCACTCGCAGCCATCTAGACCCCACCACAGCCCATTAGTTCTGAAGAGGTGTCACGTTCCCATTCACCAACACAACTACGCAGCGTCCCCCTCAACCAAAGTGGACTATGTTTCTTCCAAGAGGGCGAAGCTAGAAAGCAACGCCAGGGTCCTCAAACAGATCAGCAATAACCGCAAGTGCAGCAGTCCCAGGTCCTCTGATTCCGAAGAGAACGACAAGAGGCGGACACACAACGTTTTAGAGCGTCAGAGGCGGAACGAGCTCAAGTTGAGCTTCTTCGCCCTGCGCGACCAGGTACCGGAGGTGGCCAATAACGAGAAGGCGCCCAAAGTCGTCATCCTCAAAAAGGCAACAGAATACGTCGTTTCTATGCAGGAGGATGAGCGACGGCTCATACGGGAAACAGAACAGTTAAAGTACAGGAGAGAGCAGTTAAAACAGAGACTGCAACAGCTAAGGAACTTGGTTGTCTAA
Full Trace Sequence: gcggggagcgagtggggaagcttgtggtccggctgctgctgctattactgcaggaggaggagtgggaatcgcagcgacattgaaagccccgccggctctgagagagaagggagaggcacgacagcctgtggatttacaagcgctacagcttcattattcggactattggaagtgtatcccggcattgcttgggagaccactcggaggggaggaaggatgcctcttaatgccaatttccccagcaagaactacgactacgactatgacttgcagccctgcttcttctttctggaggaggagaacttctaccaccagcaaagccgactgcagccgccggcccccagtgaggacatctggaagaagtttgagctgctccccaccccacccctgtcacccagccgcagatccagccagtccagccttttcccctctacggctgatcagctggagatggtgaccgaattcctgggaggggacatggtcaaccagagctttatctgcgaggcggacgatgaagccttgctgaagtctatcgtcatacaggactgtatgtggagcggcttctcggcggcagccaagcttgagaaagtggtatctgagaagctggcatcctaccaggcttctaggaaagagagtgctctgtcttcttctcagtgccagagtccaccagagcagagcccacttaagtctccttcatgccatgggagcctcagtctcggagggactcggagcagccatggattcctccaggaccccagctcggattgtgttgacccttcggtggttttcccataccctctgaatgacagcatttccaacgccagctcaccttgccaagacctcatgttggaaacgccaccgatcagcagcaacagcagcagcagtgaatcagaagaggaaccggaagacgaggatgaagactgtgatgaggaagaagagattgatgttgtcacggtggaaaaaaggcagacggcatccaagcgaatggaatccagctctcactcgcagccatctagaccccaccacagcccattagttctgaagaggtgtcacgttcccattcaccaacacaactacgcagcgtccccctcaaccaaagtggactatgtttcttccaagagggcgaagctagaaagcaacgccagggtcctcaaacagatcagcaataaccgcaagtgcagcagtcccaggtcctctgattccgaagagaacgacaagaggcggacacacaacgttttagagcgtcagaggcggaacgagctcaagttgagcttcttcgccctgcgcgaccaggtaccggaggtggccaataacgagaaggcgcccaaagtcgtcatcctcaaaaaggcaacagaatacgtcgtttctatgcaggaggatgagcgacggctcatacgggaaacagaacagttaaagtacaggagagagcagttaaaacagagactgcaacagctaaggaacttggttgtctaaataacaaactctttatttacactttataaactgtgacagtctatatcaaggttgtctcttcctcgagacctactacaaaactgattttgtagaacacggacaactgcatgcagatgatttcacaactacacaaccttggcatggtctcagattctgccagcaccttaaaactgcctcaatactgggatttgggtattatgggactgttttgtttttttttgttttcctgcttgaggggtatatttgccaactttttgttgttattgttgttttacaacctttgtatttaaaacatttatttttcttataaacaaacaaattcctgaagtttggctctaaatagcttaaatatatacatcatcgctgactcatctataatatcattaatagatcgttatagaaattattgtattcacttctctaacagctatggcgcaagaaaaaaaaaaaaagtgcaaaactttggtgttttgctgccatgacgcatttaatgaactttttatgttttcgtttatttaaaaaaaaaaaacatttatcttcgagtttcatttggataattctgtattggagctagttgtaccagtttctgaagaactgatgaagaaggcactgaccaacatgtatctaaaaaatgctaaaagtacataatattatcccatcccctgtatcctcgtcatatgaaaaaccctctaacctgctggctgctcaaggcgtcctgttgtagcggcagggtagtggtctttcctagcaacacagacgcggtctgctgtttctatattgattctcttaaagatattataacatgctggtctgaaaaattcatcatttgtttggcttgttttacttaagatgaaactattcagatggggctccaacatcccataatgatatagtgacttttaacatggcaagctgtttggaataagcttcagaaaataaaaatcaagttaaaaaaataaacacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPLNANFPSKNYDYDYDLQPCFFFLEEENFYHQQSRLQPPAPSEDIWKKFELLPTPPLSPSRRSSQSSLFPSTADQLEMVTEFLGGDMVNQSFICEADDEALLKSIVIQDCMWSGFSAAAKLEKVVSEKLASYQASRKESALSSSQCQSPPEQSPLKSPSCHGSLSLGGTRSSHGFLQDPSSDCVDPSVVFPYPLNDSISNASSPCQDLMLETPPISSNSSSSESEEEPEDEDEDCDEEEEIDVVTVEKRQTASKRMESSSHSQPSRPHHSPLVLKRCHVPIHQHNYAASPSTKVDYVSSKRAKLESNARVLKQISNNRKCSSPRSSDSEENDKRRTHNVLERQRRNELKLSFFALRDQVPEVANNEKAPKVVILKKATEYVVSMQEDERRLIRETEQLKYRREQLKQRLQQLRNLVV
Donor tissue: tailbud