ORFeome > MGC76266 – XORFeome 2.0

MGC76266 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ribophorin I, mRNA (cDNA clone MGC:76266 IMAGE:5379229), complete cds
Gene Symbol: MGC76266
Gene ID: 395031
ORF gb_acc: MG132782
ORF ID: 10100

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064882

Library Location

Plate ID: GDExt11002
Well Location: E04

EST Sequences

Clone: MGC:76266 IMAGE:5379229
Trimmed Sequence: ATGGAGCGCTCAGCCGGTTTCTTCCTTTGCTTCATAGCAGCCATCGCTGTCTCCTCCAGGGCGCAGGACTTGGTGAATGAAGATGTCAAGCGCACAGTGGATCTGAGCAGCCATTTAGCTAAAGTGACGGCGGAGGTTACCATTTCCAACCCGGGACCGGGCGCCGTTCATTCCTTTCTCCTGGCTCTGGAGCCGGAGCTGGGCAGCCGTCTGGCCTACCTTGGGGTGAAAGGGGAGGATGAAGAAGATGGAGCCCTTGAAATACAAGAGACAAAAGTGAAAGGCAAAAGTGGAATGCAATACACAGTGCGTTTTGGATCCTCTCTTGCCCCCGGAGCCAAAACCAAAGTGACTGTTGAGACCGTCTTTACACACGTGCTTCAGCCCTATCCCACCCAGATAACACAGGCTGAGAAGCAGTTTGTCACTTTTGAAGGGAACCATTATTTCTTCTCACCTTACCCAACCAAGTCCCAGACCACACGCGTCAAGCTCGCCTCTAGGAATGTGGAGACTTACACCAAGCTTGGAAACCCTACCAGATCCGAGGACCTCATAGAATATGGTCCATTTAAGGATATTGCACCTTGGAGCCAGGACCTCTTAAAAGTTCACTATGAGAACAACAGCCCTTTCCTAACAATCACTAGCATGACACGTTTGATTGAGGTCTCCCACTGGGGTAACATTGCTGTGGAAGAGACGGTTGACTTGAAACACACCGGCGCATATCTGAAAGGGCCCTTTTCTAGATATGATTACCAGCGCCAGCCAGACAGTGGCATTTCATCGGTCAAATCCTTTAAGACTATACTTCCTGCTGCTGCCCAAGATGTTTATTACAGGGATGAGATTGGGAACATTTCTACAAGCCATTTGTTAATCCTCGATGACTCTGTGGAGATGGAGATCCGTCCCAGGTTCCCACTTTTTGGTGGATGGAAAACCCATTATATTATTGGATATAACCTTCCAAGTTATGAGTATCTTTACAATCTTGGTGACCAGTATGCCTTGAAGATGAGGTTTATTGATCATGTGTTTGATGACCAAGTTGTGGATTCACTAACTGTTAAGATAGTCTTGCCAGAAGGTGCCAAAAACGTCCATGTGGATAACCCCTATGATATAAACCGTGCCCCTGATGAGCTGCACTACACTTACCTGGACACATTTGGCCGAACAGTCATTGTAGCTCATAAGAACAATCTGGTTGAGCAGCATATACAAGACATTGTGGTTCATTACTCCTTCAACAAGATCCTAATGTTGCAGGAACCACTGCTGGTTGTGGGAGCATTCTACATCTTGTTTTTCACTGTCATTCTCTATGTGAGGCTGGATTTCTCCATCACGAAGGATCCAGCAGCAGAGGCCAGGATGAAAGCTGCCTGCATCACTGAGCAGATTCTCACTCTTGTAAATAAGAGACTTGGCCTGTACCGTCACTTTGATGAAGCTGTCAATAAGTATAAGCTGTCTCGGGATATAGCCACCTTAAACAGCGGCAAGAAGACACTAGAGACCGAACACAAGAACCTGACCAATGAAATTGCTTCATTACAGTCCAAACTTAAAGCTGAAGGCTCTGATCTGTGTGATAAGGTGGCAGAAATTCAGAAGCTGGACTCCCAGGTGAAGGAGATTGTGTTGAAATCCTCCTCTGAAGCCGAACGTCTGGTTTCTGGGAAACTGAAAAAGGAAACTTACATTGAGAACGAGAAGCAGCACTCAAGCCGGAGGCAGGAGCTGGTCAACAAAATAGACAACATTCTTGTTGGCTTGTAA
Full Trace Sequence: cagcagaggctgctgcaggaaggagcggagtgacagtcaatccgtgtccatctctcgctccgcagctatggagcgctcagccggtttcttcctttgcttcatagcagccatcgctgtctcctccagggcgcaggacttggtgaatgaagatgtcaagcgcacagtggatctgagcagccatttagctaaagtgacggcggaggttaccatttccaacccgggaccgggcgccgttcattcctttctcctggctctggagccggagctgggcagccgtctggcctaccttggggtgaaaggggaggatgaagaagatggagcccttgaaatacaagagacaaaagtgaaaggcaaaagtggaatgcaatacacagtgcgttttggatcctctcttgcccccggagccaaaaccaaagtgactgttgagaccgtctttacacacgtgcttcagccctatcccacccagataacacaggctgagaagcagtttgtcacttttgaagggaaccattatttcttctcaccttacccaaccaagtcccagaccacacgcgtcaagctcgcctctaggaatgtggagacttacaccaagcttggaaaccctaccagatccgaggacctcatagaatatggtccatttaaggatattgcaccttggagccaggacctcttaaaagttcactatgagaacaacagccctttcctaacaatcactagcatgacacgtttgattgaggtctcccactggggtaacattgctgtggaagagacggttgacttgaaacacaccggcgcatatctgaaagggcccttttctagatatgattaccagcgccagccagacagtggcatttcatcggtcaaatcctttaagactatacttcctgctgctgcccaagatgtttattacagggatgagattgggaacatttctacaagccatttgttaatcctcgatgactctgtggagatggagatccgtcccaggttcccactttttggtggatggaaaacccattatattattggatataaccttccaagttatgagtatctttacaatcttggtgaccagtatgccttgaagatgaggtttattgatcatgtgtttgatgaccaagttgtggattcactaactgttaagatagtcttgccagaaggtgccaaaaacgtccatgtggataacccctatgatataaaccgtgcccctgatgagctgcactacacttacctggacacatttggccgaacagtcattgtagctcataagaacaatctggttgagcagcatatacaagacattgtggttcattactccttcaacaagatcctaatgttgcaggaaccactgctggttgtgggagcattctacatcttgtttttcactgtcattctctatgtgaggctggatttctccatcacgaaggatccagcagcagaggccaggatgaaagctgcctgcatcactgagcagattctcactcttgtaaataagagacttggcctgtaccgtcactttgatgaagctgtcaataagtataagctgtctcgggatatagccaccttaaacagcggcaagaagacactagagaccgaacacaagaacctgaccaatgaaattgcttcattacagtccaaacttaaagctgaaggctctgatctgtgtgataaggtggcagaaattcagaagctggactcccaggtgaaggagattgtgttgaaatcctcctctgaagccgaacgtctggtttctgggaaactgaaaaaggaaacttacattgagaacgagaagcagcactcaagccggaggcaggagctggtcaacaaaatagacaacattcttgttggcttgtaactgttccatatccattagcagcttttgagattacggcgcaactgtgtattttgcacaatgagcctaaacaatgctcttacgatttttttttttttttttattcaatggttacagtttgtcctccctgaggatccatgggccttgctgaactggttctgactatccgtgcaacatcacatttagtcctgagcatctctagctgctgctgaatttcagtcaccatcagtttgcaacagctgtaaccttgggtttgcactgattttattattccttgttcagtgtttgttggtaccacaaacacagcactggttcttaacaccaagcccatcagaataaaagatcagtataccccatgtgcattatgatggtcacaccagctgttggcttttactgaattccggggagaggggggttgatagccacaaattgggatttggtggtctctaacagattgtcattaaagggacaaaaaataagattaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MERSAGFFLCFIAAIAVSSRAQDLVNEDVKRTVDLSSHLAKVTAEVTISNPGPGAVHSFLLALEPELGSRLAYLGVKGEDEEDGALEIQETKVKGKSGMQYTVRFGSSLAPGAKTKVTVETVFTHVLQPYPTQITQAEKQFVTFEGNHYFFSPYPTKSQTTRVKLASRNVETYTKLGNPTRSEDLIEYGPFKDIAPWSQDLLKVHYENNSPFLTITSMTRLIEVSHWGNIAVEETVDLKHTGAYLKGPFSRYDYQRQPDSGISSVKSFKTILPAAAQDVYYRDEIGNISTSHLLILDDSVEMEIRPRFPLFGGWKTHYIIGYNLPSYEYLYNLGDQYALKMRFIDHVFDDQVVDSLTVKIVLPEGAKNVHVDNPYDINRAPDELHYTYLDTFGRTVIVAHKNNLVEQHIQDIVVHYSFNKILMLQEPLLVVGAFYILFFTVILYVRLDFSITKDPAAEARMKAACITEQILTLVNKRLGLYRHFDEAVNKYKLSRDIATLNSGKKTLETEHKNLTNEIASLQSKLKAEGSDLCDKVAEIQKLDSQVKEIVLKSSSEAERLVSGKLKKETYIENEKQHSSRRQELVNKIDNILVGL
Donor tissue: tailbud