ORFeome > MGC76272 – XORFeome 2.0

MGC76272 – XORFeome 2.0

General Information

Species: Xenopus tropicalis novel galactoside-binding lectin family protein, mRNA (cDNA clone MGC:76272 IMAGE:5379255), complete cds
Gene Symbol: MGC76272
Gene ID: 431677
ORF gb_acc: MG133439
ORF ID: 10955

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC068036

Library Location

Plate ID: GDExt11010
Well Location: G02

EST Sequences

Clone: MGC:76272 IMAGE:5379255
Trimmed Sequence: ATGGCGGGATCCCTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCCCCGGTACAAGCTGAGGTTTATTTTCCACGACTGACAGTTCCATTCTGTGGCCATATAAAAGGAGGCATGAGACCAGGAAAGAAAATCCTTATTATGGGGATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGGGACTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGCTTCTAAGGAACGCTTGTGTATCCGGAAAGTGGGGAGAAGAAGAATCAGCAATACCTTATTTCCCCTTCATTGCAGATCAGCCTTTCAGGGTAGAGATACACTGCGAGCACCCGCGGCTCAGGATATTTGTGGATGGACATCAGCTGTTTGATTTTTATCATCGCGTCGAGACACTTTCAGCCATTAACACAATTAAAATTAACGGTGACCTACAACTGACCAAACTTGGTTGA
Full Trace Sequence: ccctgctgctgtcacctcctccttctccctcccgggctccagctgatccggtgccccccgcagcctttgcttatccgtgctaggcttcgctacaagatggcgggatccctggttgaaagcgaagcactgcagatgggcgttagacgtttgagcagtcccttaacgtccccggtacaagctgaggtttattttccacgactgacagttccattctgtggccatataaaaggaggcatgagaccaggaaagaaaatccttattatggggattgttaacctggagccaaagagttttgacatcaggttgacatgcggggactcagaagatccagcagccgatattgccattgagctgagagcagagtttgctgacaaacagcttctaaggaacgcttgtgtatccggaaagtggggagaagaagaatcagcaataccttatttccccttcattgcagatcagcctttcagggtagagatacactgcgagcacccgcggctcaggatatttgtggatggacatcagctgtttgatttttatcatcgcgtcgagacactttcagccattaacacaattaaaattaacggtgacctacaactgaccaaacttggttgatgactgcgatgttcctgtgccaccagtggactagttcaactgcaaccatgcaaggtcaccaagcagcgcagttccttctgccagcaaccccagtgaccttgtatttacttctgagagtaacaggccgagagactatagtcacagagagacagtttttatttgattgtagtaatggacagtgcggtacttcacaggtggctgccatgtatattacctacaattattctttttttttttttttttgacctggactacaataaactggaaactgcaagtcacatgacttgtgcttctttttttaatttttggtttgttctgaaatatatctgccatgtgtatgccacttacaccatgcagccaatgaatgaaagagatttcagttgtatgcctttcattgattggtttgacagtagcagtttccttttttttctaatttccttggttttagcatgtagcaagtacatatattttttggcaatggggggaaaagactgctactttaatactattatatcacaaggcccttacatcgtgctcttgggagcagtgggcctgcagtgtggcaaaaaaggttaatatataatcattttttaacaaagtgctaaaataacatccaaacaaaaacacttttttttgtaaaaacattgtttctgcactgaagtgtactagcctagcacaacaatatatttatatttagtcagggtatttgcatagaatgtagagtatgtttctttgcactgtgtattgttgacacttataccgctttgatggtagtttatttatctattgtacgtagcaatagaacaatccacggcattctttgcctctgagataaagtctgtaaccattttgaatgtacgaatgtgcttttgggtcagcgttcatccttgtcacatctcatgaacttaaggtatttaatgtaggttttttcacactagttagctagacaggatgatgccgggtaatgaatgtgattttcatgctttttacattttttgtaatgactcacaagtattaagacaattctgccatttttttgtaatttgttaagaactcagacagtgattccaaaaatcaaaaagaaaatctattctgagaataaaaacattgaaacacaagctgataaagacaataatggaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAGSLVESEALQMGVRRLSSPLTSPVQAEVYFPRLTVPFCGHIKGGMRPGKKILIMGIVNLEPKSFDIRLTCGDSEDPAADIAIELRAEFADKQLLRNACVSGKWGEEESAIPYFPFIADQPFRVEIHCEHPRLRIFVDGHQLFDFYHRVETLSAINTIKINGDLQLTKLG
Donor tissue: tailbud