ORFeome > MGC76279 – XORFeome 2.0

MGC76279 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76279, mRNA (cDNA clone MGC:76279 IMAGE:5379333), complete cds
Gene Symbol: MGC76279
Gene ID: 394930
ORF gb_acc: MG132796
ORF ID: 10126

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064265

Library Location

Plate ID: GDExt11002
Well Location: E05

EST Sequences

Clone: MGC:76279 IMAGE:5379333
Trimmed Sequence: ATGGCAGCACTCGTCAGATTAGGAATGAGAATAAACACACCGATAGCAGCATGCAGTGCATTACCCCAGAGCAGCTTTGTGCCCATACATTGCAGGGCAGCACGGTACAGCACAGGCCAGCATCTGAGTCATTCTAAGGGCGATCTGAGAGAAGTATTGAGTGGGCCTGTACACAGAACCCCTGCAGTAGCATCACAGATATGGAGACCACTGCACGTCACTCACACGAACCAGACAACAAAAGACAAGCTTCAGCCATCAGAGGAAGAAGTTTCAACTTTTACTAAAATAATTGAAGCGATGGGTTTTACTGGACCTCTGAAGTACAACAAATGGAAAATCAAAATTGCTGCCTTGCGCATGTATACTTGCTGCGTGGAAAGAATAGATTACGATGAATTTTTTGAAAAATGCAGTCTACCTGATACGCTAAACTCCTGGTTCCTCGTAACACAACTTCATGTCTGGATGTGCTTGGTCCGGATGAAGCAGGAAGGCCGTGCTGGCAAGTACATGTGTAGATACGTAGTGCATTCCATGTGGGAAGATGTTGAACAGCGTGGGAAAGTCATGGGGATTGATTCCGTGACCCTGAAGAACAGTATGAGATCTATGACTGAGATTTTCTACGCTGCGATATTCGGCTATGACGAGGGAATTATATCTGATGACCGAATTCTGGCTGCTGCCCTGTGGAGGAACCTATTCAACAAACAATGTGATGACCCCCGAAAGCTGGAACTAATTGTGGAATATGTACGGAAACAGGTGCAGTTCCTGGATACTCTCGATGGAGAAGACCTTCTGTTGACTGGTGAAGTAGTCTGGCGCCCTCTGGTGGAAAAAGATGCCCAAAGCATCATGAAACCTTCAACGCCGACTTATAACGACGAAGGTCTTTAA
Full Trace Sequence: ctccggcgtcactatggcagcactcgtcagattaggaatgagaataaacacaccgatagcagcatgcagtgcattaccccagagcagctttgtgcccatacattgcagggcagcacggtacagcacaggccagcatctgagtcattctaagggcgatctgagagaagtattgagtgggcctgtacacagaacccctgcagtagcatcacagatatggagaccactgcacgtcactcacacgaaccagacaacaaaagacaagcttcagccatcagaggaagaagtttcaacttttactaaaataattgaagcgatgggttttactggacctctgaagtacaacaaatggaaaatcaaaattgctgccttgcgcatgtatacttgctgcgtggaaagaatagattacgatgaattttttgaaaaatgcagtctacctgatacgctaaactcctggttcctcgtaacacaacttcatgtctggatgtgcttggtccggatgaagcaggaaggccgtgctggcaagtacatgtgtagatacgtagtgcattccatgtgggaagatgttgaacagcgtgggaaagtcatggggattgattccgtgaccctgaagaacagtatgagatctatgactgagattttctacgctgcgatattcggctatgacgagggaattatatctgatgaccgaattctggctgctgccctgtggaggaacctattcaacaaacaatgtgatgacccccgaaagctggaactaattgtggaatatgtacggaaacaggtgcagttcctggatactctcgatggagaagaccttctgttgactggtgaagtagtctggcgccctctggtggaaaaagatgcccaaagcatcatgaaaccttcaacgccgacttataacgacgaaggtctttaaacaaaccgaggggacttcatacagtaaccccgtaggatgccaagagagaagccaaatgcgtgggtcctccaccacggtttatgtgtttgttagatgatacggcatgtgaacgagttttctgagttaattagtttacatagaaacaatcagggagtcgctgtacatgcagatagcgttgacacaatcgttaccccctcattagttccattgtgggctgaattatactgtgcaatacaaccagtcatccattcttggattaaagaagttggccgaattcatgttcacagctaaatttctgttccttttcttttatccagaatataacaaaatgtgaaagactgtttggtaaaaatgtgggtttttttaattgtctattctctagagtttctttatgtatggccctcatttactagcacaggtggaaatgtgcagctgggcagtaatgagctttgatcagtccaaggcagttagaataataaaaacaggtgtctgattggtcggtaacatttacaccagtgctaacaatatgggggcctttttccatgtttatacttctcccaaacttgcctaaacaaagatatttgtgtaaaatgtctcctgcctacaattaatgtaaatgtgacacacacaatgaggggcttggggtatatttattaatagctgaaaagttcaatacagttagtcttgtcttagtcttcatcctttgataaatatgcccccatttcttattttatatctgtgtcccaagtgccaaacatcattaaacatataatattttgaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAALVRLGMRINTPIAACSALPQSSFVPIHCRAARYSTGQHLSHSKGDLREVLSGPVHRTPAVASQIWRPLHVTHTNQTTKDKLQPSEEEVSTFTKIIEAMGFTGPLKYNKWKIKIAALRMYTCCVERIDYDEFFEKCSLPDTLNSWFLVTQLHVWMCLVRMKQEGRAGKYMCRYVVHSMWEDVEQRGKVMGIDSVTLKNSMRSMTEIFYAAIFGYDEGIISDDRILAAALWRNLFNKQCDDPRKLELIVEYVRKQVQFLDTLDGEDLLLTGEVVWRPLVEKDAQSIMKPSTPTYNDEGL
Donor tissue: tailbud