ORFeome > MGC76299 – XORFeome 2.0

MGC76299 – XORFeome 2.0

General Information

Species: Xenopus tropicalis hypothetical protein MGC76299, mRNA (cDNA clone MGC:76299 IMAGE:5379666), complete cds
Gene Symbol: MGC76299
Gene ID: 394922
ORF gb_acc: MG132880
ORF ID: 10243

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064269

Library Location

Plate ID: GDExt11002
Well Location: E12

EST Sequences

Clone: MGC:76299 IMAGE:5379666
Trimmed Sequence: ATGGGCTGTTGCTACAGCGGGGAGACTGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAGAGCCAATCTCTTCCCAACAAGGCACCAAATGAATCCGAACAGAACTCCACGAATAACCCCTCGGCCCGGACTGATGAACAGGCCATGCTGTCACGCATCTTGGCCAAGACCGCTCAGAACATTATCGATGTGTCAGCGGTGGAGTCGCAGGGCATGGAGCAGCACGAGTGCATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCCAAACTCAGCAGCAATTTAATGGACTGGAAGAAAGTGCCCCCCCTCCCCTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTGCCCTTCGCAGACATACAGCAGGTCTCTAAGATCGCTGCTTACGCCTTCAGTGCACTTTCACAGATCCGCGTGGATGCTAAAGAGGATCTGGTTGTACAGTTTGGGATCCCGTAA
Full Trace Sequence: ctccacccggaagcggaactattgcctaaggagtgcggctccccccggtcatgtgacagagaggctcggctggccagagcgggctggcccggttcggttggacatgggctgttgctacagcggggagactgacaccggcaaaggggatcagggagagagggaacatctgctgccccagagccaatctcttcccaacaaggcaccaaatgaatccgaacagaactccacgaataacccctcggcccggactgatgaacaggccatgctgtcacgcatcttggccaagaccgctcagaacattatcgatgtgtcagcggtggagtcgcagggcatggagcagcacgagtgcatggacagagcccggcagtacagcacgaggctggccaaactcagcagcaatttaatggactggaagaaagtgccccccctcccctcactgacctctcagccgcaccaaatactcgccagtgaccctgtgcccttcgcagacatacagcaggtctctaagatcgctgcttacgccttcagtgcactttcacagatccgcgtggatgctaaagaggatctggttgtacagtttgggatcccgtaaccggacgctctcgccctgtctctctgacctcacgccgtcggctccatctttgttttctttaatttatcggatttttttttatatagagatttctttcagtatttccttgcttagctgtggagccgaccacctgttctacccccttttcctgccccccccatattgtccctgatgtttgcactggccatgaccactgtttgccaacaaggaaactcgccccctgctggtgaatatgcattattgggggggcggggtttgcatagtgtccccaccccccgcgctaaaggctaaactattatattgcccggcaatgaaaagctacgatttctgcttagatgtaataatctcttctagtgactgaaggattttggggggggcagacacatttggggtttccctgatcacagagcagggacccttagcctgcagccctccagttgttgagcgacagcatttcccagcaccctctgacagcaggaggcttatgggagctggtatacttacccatcctccacttcatacacctgttttatctatgataaagccaaggactggggatgctgggaaatgtagtccaacagctgcgacacctgctctgttcttgtcaccattatatacagcacaattagaggtttccctatagtaacaagcagggcacttcagtttctgtttccttttaaccccgacgtggtcccagttgcccagatggtagttaggggctggcaggatcatgtgacaaggggcggctcccagccaatggcagaggttgttactgtttatctggagagcctgcagtttgtgcccgatgcctgtaggtggcaccattccccgggtgccttgggcatgatcacacaagggttaatactaacggctcatgttggggggcatctgaggtgagaaatggggcgccctggcccctcccacaaggagaatgatttgcattaaacaaattctattttgtttctttttatatcaattgtgggaaatctctgtaacattaaacttcttacttgtcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGCCYSGETDTGKGDQGEREHLLPQSQSLPNKAPNESEQNSTNNPSARTDEQAMLSRILAKTAQNIIDVSAVESQGMEQHECMDRARQYSTRLAKLSSNLMDWKKVPPLPSLTSQPHQILASDPVPFADIQQVSKIAAYAFSALSQIRVDAKEDLVVQFGIP
Donor tissue: tailbud