ORFeome > MGC76327 – XORFeome 2.0

MGC76327 – XORFeome 2.0

General Information

Species: Xenopus tropicalis aldolase B, mRNA (cDNA clone MGC:76327 IMAGE:5380515), complete cds
Gene Symbol: MGC76327
Gene ID: 394736
ORF gb_acc: MG132976
ORF ID: 10354

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061442

Library Location

Plate ID: GDExt11004
Well Location: C03

EST Sequences

Clone: MGC:76327 IMAGE:5380515
Trimmed Sequence: ATGGCCCCGGTATTCCCAGCACTAACTGCAGAGCAGAAGAAGGAGCTGTCTGAGATTGCCCAGCGTATTGTGGCACCAGGCAAAGGAATCCTTGCAGCAGATGAGTCTGTGGGGACTATGGGAAGCCGCCTCAAGCGCATCAATGTGGAGAACATAGAAGAGAACAGACGTCTCTATCGAGAGCTTCTTTTCACTGCAGATCCCTCTATAAAAGACAGCATTGGAGGTGTCATTCTTTTCCATGAAACTCTCTACCAGAAGTCTCGAGATGGAGTTCTTTTTCCCAAAATCCTCAAGGATCTTGGCATTGTTGTAGGAATCAAGGTAGATAAAGGCACTGCTCCTTTAGCTGGAACTGATGGAGAGACCACAACACAGGGTTTGGATGGGCTTGCAGAAAGATGTGCTCAGTATAAGAAGGATGGCGCAGACTTTGCAAAGTGGCGTTGTGTGCTGAAGATCTCGGATTCTGCACCATCAAGTCTTGCTATCTATGAGAATGCTAATGTTTTGGCTCGATATGCCAGTATCTGCCAGCAGAATGGACTTGTGCCAATTGTGGAACCAGAAATCCTGTCTGATGGGTCACATGATCTCCAAAGGTGTCAGTACGAGACTGAAAAGGTCCTGTCCGCTGTGTATGCTGCCCTAATTCAGCACCATGTTTATCTGGAAGGAACTCTATTAAAACCAAATATGGTCACAGGGGGCCAGTCTTGTTCACAAAAATATACCCCACAAGATGTTGCCATGGCCACTGTCACTGCTTTAAGACGTACAGTCCCTCCTGCAGTTCCAGGTATCTGCTTCCTCTCAGGAGGTCAAAGTGAAGAAGAGGCCTCCCTTAACCTGAATGCTATGAATTGCTGCAGTCTTAATCGCCCATGGCGTGTGTCTTTCTCATACGGTCGTGCTCTACAGGCATCAGCACTCTCTGCCTGGGTTGGGAAGAGTGAGAATGAGAAAGCTGCCCAGGAAGCCTTTGTTAAGAGGGCAAAGATTAATGGTTTGGCAACTCTTGGAAAATATGTTCCATCTGGATCTTCAGATTCTGCTTCATCTCAGTCTCTGTTTCAGCCTAGTTACACCTATTAA
Full Trace Sequence: ggcgacttctctcacagcagtaagtacagtgaaattaagcacaatggccccggtattcccagcactaactgcagagcagaagaaggagctgtctgagattgcccagcgtattgtggcaccaggcaaaggaatccttgcagcagatgagtctgtggggactatgggaagccgcctcaagcgcatcaatgtggagaacatagaagagaacagacgtctctatcgagagcttcttttcactgcagatccctctataaaagacagcattggaggtgtcattcttttccatgaaactctctaccagaagtctcgagatggagttctttttcccaaaatcctcaaggatcttggcattgttgtaggaatcaaggtagataaaggcactgctcctttagctggaactgatggagagaccacaacacagggtttggatgggcttgcagaaagatgtgctcagtataagaaggatggcgcagactttgcaaagtggcgttgtgtgctgaagatctcggattctgcaccatcaagtcttgctatctatgagaatgctaatgttttggctcgatatgccagtatctgccagcagaatggacttgtgccaattgtggaaccagaaatcctgtctgatgggtcacatgatctccaaaggtgtcagtacgagactgaaaaggtcctgtccgctgtgtatgctgccctaattcagcaccatgtttatctggaaggaactctattaaaaccaaatatggtcacagggggccagtcttgttcacaaaaatataccccacaagatgttgccatggccactgtcactgctttaagacgtacagtccctcctgcagttccaggtatctgcttcctctcaggaggtcaaagtgaagaagaggcctcccttaacctgaatgctatgaattgctgcagtcttaatcgcccatggcgtgtgtctttctcatacggtcgtgctctacaggcatcagcactctctgcctgggttgggaagagtgagaatgagaaagctgcccaggaagcctttgttaagagggcaaagattaatggtttggcaactcttggaaaatatgttccatctggatcttcagattctgcttcatctcagtctctgtttcagcctagttacacctattaaacagcctgtctgtgatctattccagttgttaaaagcacaaaataccaaaatctgcatttggtgaccagtctccaatccatgccctaatgacagatttaccaacattccaaatagtattttctaaagaatgagattatttgtatgccaattgtttaagtaccataggtttttactggtatgggccaaaatctgtatatttcaattttatttcagccctctttgtactcaaagtagttccaacatttgagcaagagataaatactgtatacaaattcataaataatatttagtgtgcaacaaaatcacatcagtttgacctttttacttcttgtattattccaaaatgtatttctgccacattaaaattgatctttacatacaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAPVFPALTAEQKKELSEIAQRIVAPGKGILAADESVGTMGSRLKRINVENIEENRRLYRELLFTADPSIKDSIGGVILFHETLYQKSRDGVLFPKILKDLGIVVGIKVDKGTAPLAGTDGETTTQGLDGLAERCAQYKKDGADFAKWRCVLKISDSAPSSLAIYENANVLARYASICQQNGLVPIVEPEILSDGSHDLQRCQYETEKVLSAVYAALIQHHVYLEGTLLKPNMVTGGQSCSQKYTPQDVAMATVTALRRTVPPAVPGICFLSGGQSEEEASLNLNAMNCCSLNRPWRVSFSYGRALQASALSAWVGKSENEKAAQEAFVKRAKINGLATLGKYVPSGSSDSASSQSLFQPSYTY
Donor tissue: tadpole