ORFeome > MGC76329 – XORFeome 2.0

MGC76329 – XORFeome 2.0

General Information

Species: Xenopus tropicalis polymerase (RNA) II (DNA directed) polypeptide C, mRNA (cDNA clone MGC:76329 IMAGE:5380538), complete cds
Gene Symbol: MGC76329
Gene ID: 394729
ORF gb_acc: MG132977
ORF ID: 10355

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061444

Library Location

Plate ID: GDExt11004
Well Location: C04

EST Sequences

Clone: MGC:76329 IMAGE:5380538
Trimmed Sequence: ATGCCGTACGCGAACCAGCCTACAGTGCGGATAACGGAGCTCACTGACGAGAATGTCAAGTTTATCGTGGAAAATACTGACTTGGCAATTGCTAACTCGATCCGTAGGGTGTTCATAGCAGAAGTTCCTACTATAGCTATAGATTGGGTGCAGATAGATGCAAATTCCTCTGTTCTTCACGATGAGTTCATAGCTCACAGAGTTGGATTGATCCCTTTGACCAGTGATGATATAGTAGATAAACTGCAGTACTCTAGGGATTGTACATGTGATGAGTTTTGTCCAGAGTGCTCTGTGGAATTTACTTTGGATGTCCGATGCAATGAAGACCAGACACGCCATGTGACCTCTCGTGATCTTGTCTCAAACAACCTCCGCGTTATACCAGTGACATCACGAAGCAGAGACAATGACCCTAATGACTACGTGGAGCAAGATGATATTTTGATTGTGAAGCTCAGGAAAGGACAGGAGTTGCGTCTCCGAGCATATGCAAAGAAGGGCTTTGGAAAGGAACATGCCAAGTGGAACCCCACAGCAGGAGTGGCATTTGAATATGACCCAGATAATGCACTACGGCACACAGTATACCCCAAGCCTGAGGAATGGCCAAAGAGTGAATACTCAGAAATTGATGAAGAAGAGGCTGAGGCTCCATATGATCCAACTGGGAAACCAGAAAGGTTTTATTATAACGTGGAGTCATGCGGATCTCTTAGGCCTGAGACTATCGTTCTTTCTGCTCTCTCAGGCCTGAAAAAGAAGCTCAGCGATCTCCAAACCCAGCTTAGCCATGAAATCCAGAGTGATGTCCTCACCATTAACTGA
Full Trace Sequence: gtttctaagttgctgtgttgagaggatgccgtacgcgaaccagcctacagtgcggataacggagctcactgacgagaatgtcaagtttatcgtggaaaatactgacttggcaattgctaactcgatccgtagggtgttcatagcagaagttcctactatagctatagattgggtgcagatagatgcaaattcctctgttcttcacgatgagttcatagctcacagagttggattgatccctttgaccagtgatgatatagtagataaactgcagtactctagggattgtacatgtgatgagttttgtccagagtgctctgtggaatttactttggatgtccgatgcaatgaagaccagacacgccatgtgacctctcgtgatcttgtctcaaacaacctccgcgttataccagtgacatcacgaagcagagacaatgaccctaatgactacgtggagcaagatgatattttgattgtgaagctcaggaaaggacaggagttgcgtctccgagcatatgcaaagaagggctttggaaaggaacatgccaagtggaaccccacagcaggagtggcatttgaatatgacccagataatgcactacggcacacagtataccccaagcctgaggaatggccaaagagtgaatactcagaaattgatgaagaagaggctgaggctccatatgatccaactgggaaaccagaaaggttttattataacgtggagtcatgcggatctcttaggcctgagactatcgttctttctgctctctcaggcctgaaaaagaagctcagcgatctccaaacccagcttagccatgaaatccagagtgatgtcctcaccattaactgagttctagttctatataacatttttttttttttgtacatgtaaataaaatttttcaccctttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPYANQPTVRITELTDENVKFIVENTDLAIANSIRRVFIAEVPTIAIDWVQIDANSSVLHDEFIAHRVGLIPLTSDDIVDKLQYSRDCTCDEFCPECSVEFTLDVRCNEDQTRHVTSRDLVSNNLRVIPVTSRSRDNDPNDYVEQDDILIVKLRKGQELRLRAYAKKGFGKEHAKWNPTAGVAFEYDPDNALRHTVYPKPEEWPKSEYSEIDEEEAEAPYDPTGKPERFYYNVESCGSLRPETIVLSALSGLKKKLSDLQTQLSHEIQSDVLTIN
Donor tissue: tadpole