ORFeome > MGC79481 – XORFeome 2.0

MGC79481 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC79481 protein, mRNA (cDNA clone MGC:79481 IMAGE:6976544), complete cds
Gene Symbol: MGC79481
Gene ID: 448489
ORF gb_acc: MG133586
ORF ID: 11122

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076649

Library Location

Plate ID: GDExt11011
Well Location: B02

EST Sequences

Clone: MGC:79481 IMAGE:6976544
Trimmed Sequence: ATGGCCATTAATACCGATACCCAATATGAGAAGGCACTGGGAGGTTCAGGGAACCCTCTGCCCGCAGACTCCCATGAGACTGAGAAACTCCTCACTAATGCCTCGGAGAATAAGGAGGAGAATGGCATGAAGAAGTCATTTTCAGTCACCATGTCCAGCGAGAAGTCTATGGGAGACCTGGAACAAAATGGCCACAACCTGCCTTACAAATCGGTGTCAGCTGGGCAGCTGGAGTCTGCCCCTCTCTCACCCTCCAGGGTCAGCCTTGCCAGGGCATCCTCCACTGCCACCACCGCCCAGGAGCAGGGCAGGCCCACCGACTATCTCGTCCTGGCCATCTTCTCCTGCTTCTGCCCAGTCTGGCCAGTCAACATAGTGGCACTGGTCTTCTCCATCATGTCAAGAAACAGCCTGCAGCAGGGAGATTTAGATGGAGCGCGGAGATTAGGACGTTTGGCCAGGCTACTGAGTGTCGTCTCCATCTTGCTTGGACTTGTCATTATTGTGCTGTGCATTCTCAGCTTGACCATTTTTCACTAG
Full Trace Sequence: ctggaacatgcaccacccaagtcttccctcagctctccactaattcctcactgcagcctgcgccttctgccttcttccattccttcacacagtttttcatctccccactatttgtctaaatgggattttagcagcgctgaagcagaagtttattgttttgtggagtgagagaaagagagaaagaaagagaggaaaagccctgagtactcagcagggaataccatggccattaataccgatacccaatatgagaaggcactgggaggttcagggaaccctctgcccgcagactcccatgagactgagaaactcctcactaatgcctcggagaataaggaggagaatggcatgaagaagtcattttcagtcaccatgtccagcgagaagtctatgggagacctggaacaaaatggccacaacctgccttacaaatcggtgtcagctgggcagctggagtctgcccctctctcaccctccagggtcagccttgccagggcatcctccactgccaccaccgcccaggagcagggcaggcccaccgactatctcgtcctggccatcttctcctgcttctgcccagtctggccagtcaacatagtggcactggtcttctccatcatgtcaagaaacagcctgcagcagggagatttagatggagcgcggagattaggacgtttggccaggctactgagtgtcgtctccatcttgcttggacttgtcattattgtgctgtgcattctcagcttgaccatttttcactaggttttgcagttagaaggaagccaaatgggagatgtggacatggcctgccttcccttcacacactttttatcctcctcactgcaaatgagtctaatgttagaggaagagccaggtccagtcccactcaaggtccaagggattgcatgcagcactttaaacgccacgcccttgggaatggagagagaagcaggagtacagcgcacaagacaatggacttgaaacaagagaaatgcaagatgccaagaggaagcttttaacaggaaaccctgaagatggacagtgattggctgggcatcctgggactggcattcaggtgatggcacaaaccctgtttttatttccagcttttgtatcaaaggaatgaaagctattgtatgtattaaataatatagctgaaaactgccaaatatagggttgtgataagaaaagaccctcacatgcagcagaacgctgtgtggcctcccctgttttggatgatgatgcttcttcgctgacaaaatggaacaggacttttaatcactttttttttaaatatttttgatgggtaatttaagagaattgcaccggctgcatggttgtattccctgctgcaatggccacctcttctcctctgcttgcgttttggctggaggtgaaaatatcctaaaatatatacaggactcttgggtttggtgagatctgactgagctatacagggtgttcagtccgtgcatatggcttgtttcactcattaagtctgtccctaggcttggggctgttcttgtaggcaccgtgtacacttagaggtccaattactgcctcaaaactcaatggcgtctgtattacatcatgtttcttagcctgagattcatatgccctgaatataacacaaagagttaataggaaaattatctacaggtaatttaaaccatttacagtagatattataataatataatggtgtccctgtgacaaatgccttctggtggttggcggcagtcaattaaaagcatatcaaaactcataatatgattattatgataataatggtaaaaagtaggtgaggatccaaagatcctggtgggtttctgggatcctattcctaattggcagtccttatccccggggtctgcaatccaacagactatgggcttgttcttttcaatgcaaaacacaataagattgctctaatggaatggaaagtttcctttaatatgagataaaatctaagagctctttatttcacactggtctaatatattatataactgcttttcttttatatcgctcttaattctgtattgtatccatgctgataagggatcctccatggcacaaagagactgaatacttagcagggttgtaaaaaacaaaggaaactaaggaaacattttttatctaaaattattatctcaatatagtttgcttgtttttctttgcacacaaagcaaaagcattgcctttaattagaaatcaccagcagatcctttcattccacaccagaattggcaggtataagaaaaataaccttctgaatatgaaggaggtaacagccttgtgagctggagatctcagttggatgaaggacagaaataaaagagagaagcaaatgtcataaagaataaaaaaaaaaaaaaa
Translation: MAINTDTQYEKALGGSGNPLPADSHETEKLLTNASENKEENGMKKSFSVTMSSEKSMGDLEQNGHNLPYKSVSAGQLESAPLSPSRVSLARASSTATTAQEQGRPTDYLVLAIFSCFCPVWPVNIVALVFSIMSRNSLQQGDLDGARRLGRLARLLSVVSILLGLVIIVLCILSLTIFH
Donor tissue: tailbud