ORFeome > MGC79570 – XORFeome 2.0

MGC79570 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC79570 protein, mRNA (cDNA clone MGC:79570 IMAGE:6978762), complete cds
Gene Symbol: MGC79570
Gene ID: 493400
ORF gb_acc: MG133638
ORF ID: 11186

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080920

Library Location

Plate ID: GDExt11011
Well Location: F05

EST Sequences

Clone: MGC:79570 IMAGE:6978762
Trimmed Sequence: ATGTCCGCCACCTACACTGACCTGAGGGAGAAGCTGCAGTCCCTGTACCGGGACAGCCCGAAGGAAGTGCGGAAACGGAAGCAGCCGACCTCGGACACGGAGGAGGAGGAAGCGGCGTCTGAGCCGGAGGAAGAGGAGGAGGCGCGGAAGGTGCGGAGCGGGATCCGCCAGGTGCGGCTGTTTAGCCCGGACGAGTGCGCCCGAATTGAGGCGAAGATAGACGAGGTGGTGTCCCGGGCCGAGAAGGGCCTGTACCGGGAACACACGGTGGATCGGGCGCCGCTGCGGAACAAGTACTTCTTCGGGGAAGGCTACACGTACGGGGCCCAGCTGCAGCGGAGAGGCCCCGGGCAGGAGCGGCTCTATCCCAAGGGCGAGGTGGATGAGATCCCCGCTTGGGTCAACGAGTTGGTGATTCGCCGCCTGGTGGAGCACAGGGTCATCCCCGAGGGCTTCGTCAACAGCGCGGTCATCAACGACTACCAGCCCGGCGGCTGCATCGTGTCGCACGTCGATCCCATACACATCTTCGAGCGGCCGATCGTGTCCGTGTCCTTCTTCAGCGACTCGGCGCTCTGCTTCGGCTGCAAGTTTCAGTTCAAGCCCATCAGGGTGTCCGAACCGGTCTTCTTTCTGCCCGTACAGAGGGGCAGCGTCACTGTACTCAGCGGCTACGCGGCTGATGAAATCACACACTGCATCCGACCACAGGACATCAAGGAAAGGCGCGCCGTCGTCATACTTAGGAAAACCAGAACAGAGGCTCCTCGACTGGAAATGAAATCACTGAGCAGCAGTTACCAACCTGAGCGCCTGCAAGGCAGCAACAGGCAGCATATACTAAAACCAAAGCGGTCCCATCGCAAGGCTGACCCAGATGCTGCTCACAGACCTCGCATCCTCGAAATGGATAAAGAGGAGAACAGAAGGTCGGTACTTTTACCAAAACAGAGGAGGCGGAGCCACTTCAGCTCCGAGAACTATTGGCGAAGGTCACATGATTATGTGGACACCTATACAGAAACGGGAGAAGACGACGGCAGCCCAGTCCGCAAAGTTAAAATGAGACGACACTGA
Full Trace Sequence: cggagcatgaagtttccgtcccccctgtgacttctcagtctccctttcttgtgggggccatgcccggcgcctgctccccgcagaccggtcctggctgagtctccccacgccccccaagcgagccatgtccgccacctacactgacctgagggagaagctgcagtccctgtaccgggacagcccgaaggaagtgcggaaacggaagcagccgacctcggacacggaggaggaggaagcggcgtctgagccggaggaagaggaggaggcgcggaaggtgcggagcgggatccgccaggtgcggctgtttagcccggacgagtgcgcccgaattgaggcgaagatagacgaggtggtgtcccgggccgagaagggcctgtaccgggaacacacggtggatcgggcgccgctgcggaacaagtacttcttcggggaaggctacacgtacggggcccagctgcagcggagaggccccgggcaggagcggctctatcccaagggcgaggtggatgagatccccgcttgggtcaacgagttggtgattcgccgcctggtggagcacagggtcatccccgagggcttcgtcaacagcgcggtcatcaacgactaccagcccggcggctgcatcgtgtcgcacgtcgatcccatacacatcttcgagcggccgatcgtgtccgtgtccttcttcagcgactcggcgctctgcttcggctgcaagtttcagttcaagcccatcagggtgtccgaaccggtcttctttctgcccgtacagaggggcagcgtcactgtactcagcggctacgcggctgatgaaatcacacactgcatccgaccacaggacatcaaggaaaggcgcgccgtcgtcatacttaggaaaaccagaacagaggctcctcgactggaaatgaaatcactgagcagcagttaccaacctgagcgcctgcaaggcagcaacaggcagcatatactaaaaccaaagcggtcccatcgcaaggctgacccagatgctgctcacagacctcgcatcctcgaaatggataaagaggagaacagaaggtcggtacttttaccaaaacagaggaggcggagccacttcagctccgagaactattggcgaaggtcacatgattatgtggacacctatacagaaacgggagaagacgacggcagcccagtccgcaaagttaaaatgagacgacactgaggcggccacttttctgatcccaagaagttctgactttttcagactttctgattttttgtttctcccactcggctctccaccgtttctctgatattgccccgtggctatgggggtgcattgtaaatgatggttccccgctgctcgtgtttataccaccccacccgggtctgattgtcctcatcacacaacaaaaattggaggtgtgcaaaagccaaggggtaccatgaatactgttggagggggacacaagttaccctgaatactgttggaatcggtggctgccaggaagtctgtcagcgctgtgagttaaaagctgcaccttggcgtatagtaaggatccccattgcttgcttggcagctgcaatgagggaccagagcgcgtcggagtacaatatacaaagactcccgtggaacagtcggttgatgtttcaatgttttgtttagcacagtttctccaaccctcacccctttcttctgtttccccctccccctaaataaaagaaaccattctaatcactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSATYTDLREKLQSLYRDSPKEVRKRKQPTSDTEEEEAASEPEEEEEARKVRSGIRQVRLFSPDECARIEAKIDEVVSRAEKGLYREHTVDRAPLRNKYFFGEGYTYGAQLQRRGPGQERLYPKGEVDEIPAWVNELVIRRLVEHRVIPEGFVNSAVINDYQPGGCIVSHVDPIHIFERPIVSVSFFSDSALCFGCKFQFKPIRVSEPVFFLPVQRGSVTVLSGYAADEITHCIRPQDIKERRAVVILRKTRTEAPRLEMKSLSSSYQPERLQGSNRQHILKPKRSHRKADPDAAHRPRILEMDKEENRRSVLLPKQRRRSHFSSENYWRRSHDYVDTYTETGEDDGSPVRKVKMRRH
Donor tissue: tailbud