ORFeome > MGC79725 – XORFeome 2.0

MGC79725 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC79725 protein, mRNA (cDNA clone MGC:79725 IMAGE:6982176), complete cds
Gene Symbol: MGC79725
Gene ID: 448524
ORF gb_acc: MG133723
ORF ID: 11287

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076689

Library Location

Plate ID: GDExt11012
Well Location: H09

EST Sequences

Clone: MGC:79725 IMAGE:6982176
Trimmed Sequence: ATGATTTCTCAGGTGCGTCAGAACTACAGCCATGACTGCGAGGCAGCAGTGAACCGCATGGTGAACCTGGAAATGTATGCTTCCTACACCTACCTGTCCATGTCCCATTATTTTGACCGTGATGATGTGGCTCTTCACCACGTGGCTGAGTTCTTTAAGGAGCAGAGCAAAGAAGAGAGGGAGTGTGCCGAGAAGCTCATGAAATGCCAGAATAAGCGTGGGGGTCGCATTGTCCTGCAGGATATTAAGAAACCAGAGAGAGATGAGTGGGGAAGCACCCTGGACGCCATGCAAACAGCTTTGGATCTGGAGAAGCATGTGAACCAAGCCTTACTGGACCTGCACAACCTGGCAACTGAAAGAAAGGACCCACACATCTGTGACTTCCTGGAGTCGGAACACCTTGATGAGCAAGTCAAGCACATGAAGAAGTTTGGAGACCACATCACCAACCTGAAGCGCTTGGGGGTGCCCCAGAATGGCATGGGCGAGTACCTGTTCGACAAGCACAGCCTGAGCTAA
Full Trace Sequence: caagttcttgcttcaacagtgattgaacggaaccttctctgtccatcagatcaaacctgatttttctctacctctttgtctaaaaggacagttatattggcatcaacatgatttctcaggtgcgtcagaactacagccatgactgcgaggcagcagtgaaccgcatggtgaacctggaaatgtatgcttcctacacctacctgtccatgtcccattattttgaccgtgatgatgtggctcttcaccacgtggctgagttctttaaggagcagagcaaagaagagagggagtgtgccgagaagctcatgaaatgccagaataagcgtgggggtcgcattgtcctgcaggatattaagaaaccagagagagatgagtggggaagcaccctggacgccatgcaaacagctttggatctggagaagcatgtgaaccaagccttactggacctgcacaacctggcaactgaaagaaaggacccacacatctgtgacttcctggagtcggaacaccttgatgagcaagtcaagcacatgaagaagtttggagaccacatcaccaacctgaagcgcttgggggtgccccagaatggcatgggcgagtacctgttcgacaagcacagcctgagctaaaggagctcagcaaggacacagctagcctgcaacatcctacaatgagccgacctgcataagaacagcaggagagtccaactaatgagccattgtgtgtccctgtgttagtggggggaaagctaagtgtcctttgtgtgttgttacagattatcaataaaggattttcagcattaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MISQVRQNYSHDCEAAVNRMVNLEMYASYTYLSMSHYFDRDDVALHHVAEFFKEQSKEERECAEKLMKCQNKRGGRIVLQDIKKPERDEWGSTLDAMQTALDLEKHVNQALLDLHNLATERKDPHICDFLESEHLDEQVKHMKKFGDHITNLKRLGVPQNGMGEYLFDKHSLS
Donor tissue: tadpole