ORFeome > MGC79729 – XORFeome 2.0

MGC79729 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC79729 protein, mRNA (cDNA clone MGC:79729 IMAGE:6982463), complete cds
Gene Symbol: MGC79729
Gene ID: 493299
ORF gb_acc: MG133671
ORF ID: 11225

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080359

Library Location

Plate ID: GDExt11012
Well Location: D07

EST Sequences

Clone: MGC:79729 IMAGE:6982463
Trimmed Sequence: ATGGCGGTGACCAGGCGGGACCTGCTCATGCACGTGCTTGTGGCCCTATTCGGGATGGGCTCCTGGGTTTCCGTAAATTCTCTGTGGGTGGAGCTTCCTGTGGTGGTGAAAGAACTTCCTGAAGGTTGGAACCTCCCCGCGTTCCTGACGGTACTTATCGCCCTGGGTAACATCGGACCCCTCGCAGTCACCCTGAGCCACCGGTTCTGCCCCCCGGGCCGGGTCTCGGAGCCGTGGCTCATACGCTCAGTACAAGCGCTCAGCCTGGTGTCGGCGGGTTTCCTGGCGGGGTTCTGGGACCGGCGGGTTCTGGTGGCGGGGGAGGAGCGCAGCGTTCCGTACCTGCTCCTGGGGTTCCTATTGGCTCTCGGCTGCTGCACCTCCAACGTCACCTTCCTGCCCTTCATGTACAGTTTCCCCCAGCAGTTTGTGCGCAGTTTCTTCATTGGTCAGGGCCTTAGTGCCCTCCTGCCCTGTGTGTTGGCGCTGGGGCAGGGGGTGGGGCGCCTGGAGTGCCGCAATGGCACGTGGGGGAATCACAGCGAACCCCACTACCTGCAGGAGAACTTCCCCGCCTCCTCCTACTTCTGGGGTCTCTTCTGCTTCCTGGGGGTCTCTGCACTGGCCTTCCTTCTGCTGCTTGTCCTACGTGGGCGCAATAAGGAGGAGGAGCAAGGGGAGGGGCCAACACAGCAGGGAGATGGGGGCTCCGAGGATTCCTACCCCCTGAAATCCCCTGAGGAGGAACAGCCCCAAGAGCCCCCTGATGCCAGTAATAGGGGGCAGAGATTCTGGACTGCACGGAACGTGTACTTACTGGCGCTTTTGGGCTTGTCCAACGCACTGACCAATGGGATTCTGCCCTCCGTACAGACTTACAGTTGCCTCCCCTATGGGCCCGACGCCTACCACCTGTCTGTCGTCCTTAGCAACATCGCCAATCCCGCGGCCTGCTTCATCGCCATGTGTGCGCTGTGTAGGTCGTCGCTGGTTCTTGGGGTGATTATGGCGGTTGGAATGATATTCGGGGGGTACCTCATGTTCTTGGCTGCCCTCAGTCCGTGTCCCCCCCTAGTGGGCAGCTTGGCAGGGGTTGTGCTAGTGATCTTGTGCTGGACACTGTTCCTGGGGCTCCTGTCGTACCTAAAGGTGGTTATTGGGAGCCTGTTGCATGAAGCCGGGCACAGCGCCCTCCTGTGGTGTGGAGCAGTAATACAGATGGGCTCCCTGGTGGGGGCGCTGCTCATGTTCCCCATGGTCAGTATCTACCACCTGTTCCAGAGCGGCCGTGACTGCCAGGACAACTGCCCCCTGTGA
Full Trace Sequence: cggaagtgcccggaacacgtgggtaagaaggtctctccgctccgtcccggcaacttccccgccccccccaggctcctcactgcgcaaagtgatgtcagcaaccgaccggggcgccaactgccaccctccggagacacccacactctgatggtagagggttattgtgtcccagtggggtaattactgctgctgatacagattccaccctgacagaacttcagcccgaactgcgtgtccccctcctccctaaaccgcatcataaatacagcagggccccagagatggcggtgaccaggcgggacctgctcatgcacgtgcttgtggccctattcgggatgggctcctgggtttccgtaaattctctgtgggtggagcttcctgtggtggtgaaagaacttcctgaaggttggaacctccccgcgttcctgacggtacttatcgccctgggtaacatcggacccctcgcagtcaccctgagccaccggttctgccccccgggccgggtctcggagccgtggctcatacgctcagtacaagcgctcagcctggtgtcggcgggtttcctggcggggttctgggaccggcgggttctggtggcgggggaggagcgcagcgttccgtacctgctcctggggttcctattggctctcggctgctgcacctccaacgtcaccttcctgcccttcatgtacagtttcccccagcagtttgtgcgcagtttcttcattggtcagggccttagtgccctcctgccctgtgtgttggcgctggggcagggggtggggcgcctggagtgccgcaatggcacgtgggggaatcacagcgaaccccactacctgcaggagaacttccccgcctcctcctacttctggggtctcttctgcttcctgggggtctctgcactggccttccttctgctgcttgtcctacgtgggcgcaataaggaggaggagcaaggggaggggccaacacagcagggagatgggggctccgaggattcctaccccctgaaatcccctgaggaggaacagccccaagagccccctgatgccagtaatagggggcagagattctggactgcacggaacgtgtacttactggcgcttttgggcttgtccaacgcactgaccaatgggattctgccctccgtacagacttacagttgcctcccctatgggcccgacgcctaccacctgtctgtcgtccttagcaacatcgccaatcccgcggcctgcttcatcgccatgtgtgcgctgtgtaggtcgtcgctggttcttggggtgattatggcggttggaatgatattcggggggtacctcatgttcttggctgccctcagtccgtgtccccccctagtgggcagcttggcaggggttgtgctagtgatcttgtgctggacactgttcctggggctcctgtcgtacctaaaggtggttattgggagcctgttgcatgaagccgggcacagcgccctcctgtggtgtggagcagtaatacagatgggctccctggtgggggcgctgctcatgttccccatggtcagtatctaccacctgttccagagcggccgtgactgccaggacaactgccccctgtgaagtgcacttacaccaaggaaacactagggctgtgccccccccccaaaagaaaataaacatttttatggtttttgtagtaaatcaaataaaacttttgggtattttggtctgtgaaaaaaaaaaaaaaaaaaaaaa
Translation: MAVTRRDLLMHVLVALFGMGSWVSVNSLWVELPVVVKELPEGWNLPAFLTVLIALGNIGPLAVTLSHRFCPPGRVSEPWLIRSVQALSLVSAGFLAGFWDRRVLVAGEERSVPYLLLGFLLALGCCTSNVTFLPFMYSFPQQFVRSFFIGQGLSALLPCVLALGQGVGRLECRNGTWGNHSEPHYLQENFPASSYFWGLFCFLGVSALAFLLLLVLRGRNKEEEQGEGPTQQGDGGSEDSYPLKSPEEEQPQEPPDASNRGQRFWTARNVYLLALLGLSNALTNGILPSVQTYSCLPYGPDAYHLSVVLSNIANPAACFIAMCALCRSSLVLGVIMAVGMIFGGYLMFLAALSPCPPLVGSLAGVVLVILCWTLFLGLLSYLKVVIGSLLHEAGHSALLWCGAVIQMGSLVGALLMFPMVSIYHLFQSGRDCQDNCPL
Donor tissue: tadpole