ORFeome > MGC79767 – XORFeome 2.0

MGC79767 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC79767 protein, mRNA (cDNA clone MGC:79767 IMAGE:6984892), complete cds
Gene Symbol: MGC79767
Gene ID: 493439
ORF gb_acc:
ORF ID: 11289

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080976

Library Location

Plate ID: GDExt11012
Well Location: G11

EST Sequences

Clone: MGC:79767 IMAGE:6984892
Trimmed Sequence: ATGTTCAAGTTTGTGCTTCTTGCGATCTGCGTGGGCTATGCCTACAGTTGTGGGGTTCCAGCTGTCGCCCCCAAAGTTACCAGGGTTGTCGGTGGAGAAGATGTAGTGCCACACAGTTGGCCATGGCAGATCTCCCTCCAGTATCAGGGAACCAGTGGTGCTTGGGGTCACACCTGCGGCGGAACCCTCATCTCTGAACAGTGGGTCCTGACTGCTGCACATTGTATCAGCTCTGGCCGTGTCTACAGAGTGTTCCTGGGCAAGCACAGCCTGCAGCAGGATGAGGCTGAAGCCGTCGCTATCACCCCTGAGAAAATCATTGTCCATGAGAAGTGGAATTCCCTTTTCATTATCAACGACATTGCTCTGATCAAGCTGTCCCAGCCTGCTCCTCTGAGCGAAGCGATCCAACCAGCCTGCATTCCTTCCAGCGGTGCCATCCTCGCCAACGACTTCCCCTGCTTTGTGACTGGATGGGGGCGCCTCTACACCAACGGACCAATCGCTGACAACTTGCAACAAGCCCTTCTGCCCGTTGTGGACCATGCCACTTGCACCCTGCGTGACTGGTGGGGAAGCCAGGTTCAGACCACCATGGTCTGTGCTGGTGGTGATGGAATCGTGTCTGGCTGCAATGGTGATTCTGGTGGCCCTCTGAACTGCCAGGCAGCAGGTGGAGCTTGGGAAGTCCACGGCATTGTCAGCTTCGGCTCTGGCATTAGCTGCAACTATGCCAAGAAACCAACCGTCTTCACCCGTGTGTCCGCCTATAACGACTGGATCAGCGAGAAAATTGCCAGCAATTAA
Full Trace Sequence: gaattcaccatgttcaagtttgtgcttcttgcgatctgcgtgggctatgcctacagttgtggggttccagctgtcgcccccaaagttaccagggttgtcggtggagaagatgtagtgccacacagttggccatggcagatctccctccagtatcagggaaccagtggtgcttggggtcacacctgcggcggaaccctcatctctgaacagtgggtcctgactgctgcacattgtatcagctctggccgtgtctacagagtgttcctgggcaagcacagcctgcagcaggatgaggctgaagccgtcgctatcacccctgagaaaatcattgtccatgagaagtggaattcccttttcattatcaacgacattgctctgatcaagctgtcccagcctgctcctctgagcgaagcgatccaaccagcctgcattccttccagcggtgccatcctcgccaacgacttcccctgctttgtgactggatgggggcgcctctacaccaacggaccaatcgctgacaacttgcaacaagcccttctgcccgttgtggaccatgccacttgcaccctgcgtgactggtggggaagccaggttcagaccaccatggtctgtgctggtggtgatggaatcgtgtctggctgcaatggtgattctggtggccctctgaactgccaggcagcaggtggagcttgggaagtccacggcattgtcagcttcggctctggcattagctgcaactatgccaagaaaccaaccgtcttcacccgtgtgtccgcctataacgactggatcagcgagaaaattgccagcaattaagaacaagcgcaatttccatcatatccgcaacaacagggcatctgattcgtgcattcctcgtatttcctttaacacctcgtgtcatacacattttggatttcgcaataaagtgacaaagcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MFKFVLLAICVGYAYSCGVPAVAPKVTRVVGGEDVVPHSWPWQISLQYQGTSGAWGHTCGGTLISEQWVLTAAHCISSGRVYRVFLGKHSLQQDEAEAVAITPEKIIVHEKWNSLFIINDIALIKLSQPAPLSEAIQPACIPSSGAILANDFPCFVTGWGRLYTNGPIADNLQQALLPVVDHATCTLRDWWGSQVQTTMVCAGGDGIVSGCNGDSGGPLNCQAAGGAWEVHGIVSFGSGISCNYAKKPTVFTRVSAYNDWISEKIASN
Donor tissue: tadpole