ORFeome > MGC79798 – XORFeome 2.0

MGC79798 – XORFeome 2.0

General Information

Species: Xenopus tropicalis RAN binding protein 3, mRNA (cDNA clone MGC:79798 IMAGE:6986317), complete cds
Gene Symbol: MGC79798
Gene ID: 448196
ORF gb_acc: MG133759
ORF ID: 11328

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075117

Library Location

Plate ID: GDExt11014
Well Location: C02

EST Sequences

Clone: MGC:79798 IMAGE:6986317
Trimmed Sequence: ATGGCGGACCTGGCAAACGAAGAAAAGCCTGCTATAGCACCTCCTGTCTTTGTGTTTCAGAAGGATAAGGGACAGAAGAGATCAGCTGATGGTTCCAGTCCAGAGCAAGAAGATTCTGACAGAGAAGATAGCAGTTACTGCCCACCTGTAAAAAGAGAGCGAACCTCCTCCTTTTCACAGTTTCCTCCTTCACAGTCTGTGACGAAGAACAATGTCTTCATGCCATCTAGCTTCTGTCAACCCTCCACTGGTAATTCTGACTCTGAGCCAGAGGAGAAATGCAGTGGATTCAGGCTAAAACCCCCCACCCTTATTCATGGACAAGCACCTAGTGCAGGTCTTCCAAGCCAGAAACCTAAGGAGCAGCAGCGCAGTGTTCTGCGTCCAGCAGTATTACAAGCTCCACAGCAGAAGACCTTTTCGGCACCTGGCTTCAGTAGTGGAACAAATGGCATCAGTCTGTCTTCTGAACCCTCAGCTTCCTGCCCAGATGCTCCAGCAGAAAGCCCATCCATACATCAGATAAACTCTGATGCTGATAGAAAAGACAGCAATGCACAGACAGAGTCTTGTATTGTAAAAGACTCCAGTGAAGACTCAGAACAGGGTGAGCAGAAGACACAACAGTCCTTCGTCTTTGGGCAGAACGTGCGTGACAGGGTAAAACTTGGAGTGCAAAGTAAAGATTCACCTGATGATGAGAAAGTGGGGTCCCAAGGTGTGGATGCCCCAGCACAGACCAATTACTTTCTACAGTACATCAGCTCAAGTCTAGAGAACTCTACGCACAAATCTGAAGCAGCCAGCAACAAGTTTGTATTTGGACAGAATATGATTGAGCGAGTTCTGAGTCCACCCAAAGCAGAGCCAAGCTCTGACAGCAACAAGGAGAATTCTGTTTTAGAGAGTGGGTCTGAAAGTTCTTCACTGGACAACACTCCAGAAAAATCTAATAATATCTCAGAATCCCTGGAAGAGTCTGCAGCTGCCTACACAAAGGCTACTGCAAAAAGATGTTTGCTGGAGAAAGTTGAGGTTATCACAGGAGAGGAGGCAGAGAGCAATGTATTGCAGATTCAATGCAAATTGTTTGTGTTCGATAAAGTGTCGCAGTCCTGGGTAGAGAGAGGTCGAGGTCTCTTAAGGCTGAATGACATGGCCTCCACAGAGGATGGCTTACTACAGTCCCGTCTGGTTATGCGCACGCAAGGTAGCCTGCGGTTAATTCTTAACACTAAACTCTGGGCGCAAATGCAAATAGACAAAGCCAGTGAAAAAAGCATCCGCATCACTGCCATGGACACAGAGGACCAAGGTGTTAAAGTTTTTCTGATATCGGCAAGCTCTAAAGATACTGGACAGCTTTTTGCTGCATTACATCACCGCATCCTTGCTTTAAGGAGTCATGTTGAGCAGGAGGCTGAAATAAAGTGTCCAGAACCTGTTAGGGAAGTGGCCCAGTCCATTGAAGAGGACAGTGATGATGATGACGATGTCCTCACCCCCTCAGGGGCAAATGTTGGAGCACCCGGTGACGAGGGAGACAAGCTACCAGCATCCAGTACATAG
Full Trace Sequence: ctgtgaaagcgtccgcgaagcattgtgggagcggctgaggcggtaaaatggcggacctggcaaacgaagaaaagcctgctatagcacctcctgtctttgtgtttcagaaggataagggacagaagagatcagctgatggttccagtccagagcaagaagattctgacagagaagatagcagttactgcccacctgtaaaaagagagcgaacctcctccttttcacagtttcctccttcacagtctgtgacgaagaacaatgtcttcatgccatctagcttctgtcaaccctccactggtaattctgactctgagccagaggagaaatgcagtggattcaggctaaaaccccccacccttattcatggacaagcacctagtgcaggtcttccaagccagaaacctaaggagcagcagcgcagtgttctgcgtccagcagtattacaagctccacagcagaagaccttttcggcacctggcttcagtagtggaacaaatggcatcagtctgtcttctgaaccctcagcttcctgcccagatgctccagcagaaagcccatccatacatcagataaactctgatgctgatagaaaagacagcaatgcacagacagagtcttgtattgtaaaagactccagtgaagactcagaacagggtgagcagaagacacaacagtccttcgtctttgggcagaacgtgcgtgacagggtaaaacttggagtgcaaagtaaagattcacctgatgatgagaaagtggggtcccaaggtgtggatgccccagcacagaccaattactttctacagtacatcagctcaagtctagagaactctacgcacaaatctgaagcagccagcaacaagtttgtatttggacagaatatgattgagcgagttctgagtccacccaaagcagagccaagctctgacagcaacaaggagaattctgttttagagagtgggtctgaaagttcttcactggacaacactccagaaaaatctaataatatctcagaatccctggaagagtctgcagctgcctacacaaaggctactgcaaaaagatgtttgctggagaaagttgaggttatcacaggagaggaggcagagagcaatgtattgcagattcaatgcaaattgtttgtgttcgataaagtgtcgcagtcctgggtagagagaggtcgaggtctcttaaggctgaatgacatggcctccacagaggatggcttactacagtcccgtctggttatgcgcacgcaaggtagcctgcggttaattcttaacactaaactctgggcgcaaatgcaaatagacaaagccagtgaaaaaagcatccgcatcactgccatggacacagaggaccaaggtgttaaagtttttctgatatcggcaagctctaaagatactggacagctttttgctgcattacatcaccgcatccttgctttaaggagtcatgttgagcaggaggctgaaataaagtgtccagaacctgttagggaagtggcccagtccattgaagaggacagtgatgatgatgacgatgtcctcaccccctcaggggcaaatgttggagcacccggtgacgagggagacaagctaccagcatccagtacatagcacccacctcttacaacagctcccctttaacctcattgggtgatagtccaccgctcccttctaaccttatggagtattgaagaccagctcctaaaagcaaggcagagcttaaggacacagacttctcacccatcccctggaactgctattttttttttttttttttttcacgttaaatcagaataaacatactttgggttcctatcaaggtatttttatttttcttccccctgaagatgttacacgtggaatccatccaatcttatacatgaagagcttttgcctggatgtctgaggatataaccgctcatcatattgatgagccaaagaaaatttccacctgccccaccaccctcttgtaactgaagttgacagcaaagacaataccatcattcaaaaatgtaattttctttttatataatgaaatgttgcctcagtcttttcctattgcgtccccccaacctccaaaaaaaaaatctgtgtgtgtaaatatatgtataaatttttttcatgcccttcattgcttttatttttggattcttgaccaggacctacccattttctgagagatgtataggaccatcctacctttcccaagtccctccacttctaaactttaaatgactgccatctgtggcttatcaaattggaatacactttggagctacacacagttttaaaaacactcttggacaaattgcattctcctttaagacttaaaacctattggttataaatgggatattccagtttttctcctttcctttttctgggtaactttctgttgtgcttcaagatatttttttagtttgacatatatgcttttttttgtgtgctaaaaaagtgaaatgttatttttttgtatccttatttaagggaaagagttaaggaattctgtattctcaaaacaaaaatctcaaataaaacaagaataaaaaaaagagaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaa
Translation: MADLANEEKPAIAPPVFVFQKDKGQKRSADGSSPEQEDSDREDSSYCPPVKRERTSSFSQFPPSQSVTKNNVFMPSSFCQPSTGNSDSEPEEKCSGFRLKPPTLIHGQAPSAGLPSQKPKEQQRSVLRPAVLQAPQQKTFSAPGFSSGTNGISLSSEPSASCPDAPAESPSIHQINSDADRKDSNAQTESCIVKDSSEDSEQGEQKTQQSFVFGQNVRDRVKLGVQSKDSPDDEKVGSQGVDAPAQTNYFLQYISSSLENSTHKSEAASNKFVFGQNMIERVLSPPKAEPSSDSNKENSVLESGSESSSLDNTPEKSNNISESLEESAAAYTKATAKRCLLEKVEVITGEEAESNVLQIQCKLFVFDKVSQSWVERGRGLLRLNDMASTEDGLLQSRLVMRTQGSLRLILNTKLWAQMQIDKASEKSIRITAMDTEDQGVKVFLISASSKDTGQLFAALHHRILALRSHVEQEAEIKCPEPVREVAQSIEEDSDDDDDVLTPSGANVGAPGDEGDKLPASST
Donor tissue: gastrula