ORFeome > MGC88881 – XORFeome 2.0

MGC88881 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC88881 protein, mRNA (cDNA clone MGC:88881 IMAGE:6998288), complete cds
Gene Symbol: MGC88881
Gene ID: 448207
ORF gb_acc: MG134054
ORF ID: 11673

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075265

Library Location

Plate ID: GDExt11016
Well Location: C09

EST Sequences

Clone: MGC:88881 IMAGE:6998288
Trimmed Sequence: ATGGATAGGAAACAACCCTATAAAGCATTGTTAAAGGTATCTAAAAAGTATGGCCCTGTATGCAGTTTTCAGATAGGACCATTGAAGACGGTTGTCCTGTGTGGCTATGATACAGTGAAAGATGCCCTTCTCAATGATGAGTTTGCTGACCGGCCTGCCATGCCTATGCTTGATGATGTAGCCAAAGGCCACGGTATTCTCTCTTCCAATGGTGAGAACTGGAGGGTGATGAGACGCTTTGCTCTTTCGACACTTAGAGACTTTGGAATGGGGAAGAAGACGATAGAGAGCAAGATCAATGAAGAATGTGATCATTTAGTGCAAAAGTTTAGCTCCTACGGAGGAAAACCCTTTGACACCACTATGATAATGAACGCAGCTGTAGCCAACATAATCGCTTCCATTTTACTCAGTCATCGATTTCATTATGAAAATCCAACGTTGCTGAGACTCCTGAAATTAGTGAATGAAAACACGAAGTTCATGGCAAGCCGCATAGCCATGCTCTACAACACTTTCCCCTCTATAATGCGTTGGATACCCGGATGCCACAAATCCATTTATAAGAACGCACAGGAGCTGCTGGAATTTATTAGAGAGACTTTTTCAAAACAAAAAGTCGAGTTGGACATAAATGACCAGAGAAACCTCATCGATGCATTCCTTTCCAGGCAACAGGAGCCTAATTCTGGAAAATATTTCCACGATGACAATCTGACAATACTCGTGTTTGATTTATTTGTTGCCGGCATGGAGACAACTTCAACGACTCTGAGATGGGCACTTCTGTTAATGATGAAATATCCAGAAATCCAAAAGAAGGTCCAAGATGAAATAGAGAAAGTGATTGGCTCAGCTGAGCCCAGAGCAGAGCACAGGAAAGAGATGCCCTATACTGATGCTGTAATCCATGAAATCCAGAGATTTGCCAACATCTTTCCAATGAATGGCCCCCATGCAACTACAAAGGATGTCACTTTCAGGGGATTTCTAATACCCAAAGGCACCTTTGTAATTCCATTGCTGGCATCTGTACTGAAAGATGAGAATTACTTTAAGAAGCCGAATGAATTTTACCCGGAACATTTCCTCGACTCAGAAGGACATTTTGTGAAAAACGACGCGTTCCTTCCCTTCTCAGCAGGCCGCAGAAGCTGTGCCGGAGAGAATTTGGCTAGAATGGAACTGTTCCTGTTCTTCACAAGCCTCCTGCAGAACTTCACATTTCAGGCTCCACCTGGGGAGGAACTTGATCTCACCCCTGACGTTGGTATCGCTACGCCCCCTATGCAACATACTGTTTGTGCTTTGCCTCGTGCCTGA
Full Trace Sequence: ttcagtaggcgcttcagaagttcactcctactcccctgtatttttatatatatatataatattatgtgcataatgtgggtgcaacaggaagcgaggggaagaacagagagctctgtatgggaccctgggactcagggttactgggaagcctaagggatcctgtatataggtcagggtggaaccatgttggccgctgatccaatgacaatactcctctcagcctttatttgccttcttctgggatttgttttgtttggcaggaaaaggaatgtttgtcagaatttccctccgggtccaagaccccttccagttattggcaatttactccttatggataggaaacaaccctataaagcattgttaaaggtatctaaaaagtatggccctgtatgcagttttcagataggaccattgaagacggttgtcctgtgtggctatgatacagtgaaagatgcccttctcaatgatgagtttgctgaccggcctgccatgcctatgcttgatgatgtagccaaaggccacggtattctctcttccaatggtgagaactggagggtgatgagacgctttgctctttcgacacttagagactttggaatggggaagaagacgatagagagcaagatcaatgaagaatgtgatcatttagtgcaaaagtttagctcctacggaggaaaaccctttgacaccactatgataatgaacgcagctgtagccaacataatcgcttccattttactcagtcatcgatttcattatgaaaatccaacgttgctgagactcctgaaattagtgaatgaaaacacgaagttcatggcaagccgcatagccatgctctacaacactttcccctctataatgcgttggatacccggatgccacaaatccatttataagaacgcacaggagctgctggaatttattagagagactttttcaaaacaaaaagtcgagttggacataaatgaccagagaaacctcatcgatgcattcctttccaggcaacaggagcctaattctggaaaatatttccacgatgacaatctgacaatactcgtgtttgatttatttgttgccggcatggagacaacttcaacgactctgagatgggcacttctgttaatgatgaaatatccagaaatccaaaagaaggtccaagatgaaatagagaaagtgattggctcagctgagcccagagcagagcacaggaaagagatgccctatactgatgctgtaatccatgaaatccagagatttgccaacatctttccaatgaatggcccccatgcaactacaaaggatgtcactttcaggggatttctaatacccaaaggcacctttgtaattccattgctggcatctgtactgaaagatgagaattactttaagaagccgaatgaattttacccggaacatttcctcgactcagaaggacattttgtgaaaaacgacgcgttccttcccttctcagcaggccgcagaagctgtgccggagagaatttggctagaatggaactgttcctgttcttcacaagcctcctgcagaacttcacatttcaggctccacctggggaggaacttgatctcacccctgacgttggtatcgctacgccccctatgcaacatactgtttgtgctttgcctcgtgcctgaggctagtgcgttgactaactgaatattcctcttaaaatgtactttgttatcttgagttacatttgtagtttgggttctgcaggctggaggggccacgccaacacaaaatgtaataaaaacgttctaattttaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDRKQPYKALLKVSKKYGPVCSFQIGPLKTVVLCGYDTVKDALLNDEFADRPAMPMLDDVAKGHGILSSNGENWRVMRRFALSTLRDFGMGKKTIESKINEECDHLVQKFSSYGGKPFDTTMIMNAAVANIIASILLSHRFHYENPTLLRLLKLVNENTKFMASRIAMLYNTFPSIMRWIPGCHKSIYKNAQELLEFIRETFSKQKVELDINDQRNLIDAFLSRQQEPNSGKYFHDDNLTILVFDLFVAGMETTSTTLRWALLLMMKYPEIQKKVQDEIEKVIGSAEPRAEHRKEMPYTDAVIHEIQRFANIFPMNGPHATTKDVTFRGFLIPKGTFVIPLLASVLKDENYFKKPNEFYPEHFLDSEGHFVKNDAFLPFSAGRRSCAGENLARMELFLFFTSLLQNFTFQAPPGEELDLTPDVGIATPPMQHTVCALPRA
Donor tissue: