ORFeome > MGC88972 – XORFeome 2.0

MGC88972 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC88972 protein, mRNA (cDNA clone MGC:88972 IMAGE:7003620), complete cds
Gene Symbol: MGC88972
Gene ID: 448246
ORF gb_acc: MG134009
ORF ID: 11613

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075309

Library Location

Plate ID: GDExt11016
Well Location: G08

EST Sequences

Clone: MGC:88972 IMAGE:7003620
Trimmed Sequence: ATGGAGAGATCCCAGGGCAAAGTGTGCAACAAAGATAAAAGTGAGAGCATTGAAGAGACACATTTCTTTGCAGCCTGTGACTGTGAGGAGGACTTTACTCGAGGGAAACCAATTAGAGGGAGAACAAAATCCAGAAGCTTATCTGCATCTCCAGCACCAGGGAGCACCAAGGAATTCAGGCGTACAAGATCCATGCATGGACCATGCCCAGTAACCACTTTTGGACCAAAGGCCTGTATGCTGCAGAATCCAAAAGCAATCATGCATATTCAGGACCCAGCAAGCCAGCTGCTAACTTGGAACAAGCCTCCCAAAAGTGTCCTGGTGATAAAGAAAGTCAGAGATGCCAGTCTGCTGAAGCCTTTTAAAGAGCTTTGTGTGTTTCTTACAGAGGAGAAGAACATGATTGTTTATGTGGAAAAAAAAGTCCTTGAAGATCCTGCTATTGCTAACGATGAAAACTTTGGACCAGTTAAGAAGAAATTTTGCACATTTAGAGAAGATTACGATGACATATCCAATCAAATTGACTTCATTATTTGCCTTGGAGGGGATGGGACTTTACTCTATGCATCATCACTTTTTCAGGATAGTGTTCCTCCGGTGATGGCGTTTCATTTGGGATCACTGGGTTTCCTCACCCCCTTTAACTTTGATAACTTCCAAACTCAAGTCACTCAGGTTATAGAAGGTAATGCCGCTCTTGTACTACGCAGCAGGTTAAAGGTGAAAGTGTCCAAAGAGCACAAAGAGAAGAAAACTGTACTACAGAATGGAGTGGAGGAAAATGGCCTCATAGTCAAATCTGAAAAGGAACCAATAAAGCAAACAAAATATCAGGTCCTCAATGAAGTTGTAGTAGACAGAGGTCCTTCTTCCTATCTCTCCAATGTAGATGTCTTTCTAGATGGGCACCTTATAACGACAGTGCAAGGCGATGGGGTCATTGTATCTACACCTACTGGCAGTACTGCATATGCAGCTGCAGCTGGAGCCTCCATGATTCACCCCAATGTCCCAGCAATTATGATCACGCCCATCTGCCCACACTCCCTCTCCTTCCGACCAATTGTGGTCCCTGCTGGAGTCGAGCTCAAGATCATGCTATCCCCTGATGCACGGAACACTGCTTGGGTATCATTTGATGGGAGGAAAAGACAAGAAATCAGCCATGGAGACAGTATTAGCATCACTACCTCGTGTTACCCTGTCCCTTCCATCTGTTTTCGGGACCCAGTGAACGACTGGTTTGACAGCTTGGCCGAGTGCTTACATTGGAACGTGCGGAAGAAGCAAAACCATTTCACTGAAGAGGAGGAGGAAGACGGGGACTTTTAA
Full Trace Sequence: caacaagtaatgttcaagggaagttttatctccttgagtgaaacgtatcagattccataatggagagatcccagggcaaagtgtgcaacaaagataaaagtgagagcattgaagagacacatttctttgcagcctgtgactgtgaggaggactttactcgagggaaaccaattagagggagaacaaaatccagaagcttatctgcatctccagcaccagggagcaccaaggaattcaggcgtacaagatccatgcatggaccatgcccagtaaccacttttggaccaaaggcctgtatgctgcagaatccaaaagcaatcatgcatattcaggacccagcaagccagctgctaacttggaacaagcctcccaaaagtgtcctggtgataaagaaagtcagagatgccagtctgctgaagccttttaaagagctttgtgtgtttcttacagaggagaagaacatgattgtttatgtggaaaaaaaagtccttgaagatcctgctattgctaacgatgaaaactttggaccagttaagaagaaattttgcacatttagagaagattacgatgacatatccaatcaaattgacttcattatttgccttggaggggatgggactttactctatgcatcatcactttttcaggatagtgttcctccggtgatggcgtttcatttgggatcactgggtttcctcaccccctttaactttgataacttccaaactcaagtcactcaggttatagaaggtaatgccgctcttgtactacgcagcaggttaaaggtgaaagtgtccaaagagcacaaagagaagaaaactgtactacagaatggagtggaggaaaatggcctcatagtcaaatctgaaaaggaaccaataaagcaaacaaaatatcaggtcctcaatgaagttgtagtagacagaggtccttcttcctatctctccaatgtagatgtctttctagatgggcaccttataacgacagtgcaaggcgatggggtcattgtatctacacctactggcagtactgcatatgcagctgcagctggagcctccatgattcaccccaatgtcccagcaattatgatcacgcccatctgcccacactccctctccttccgaccaattgtggtccctgctggagtcgagctcaagatcatgctatcccctgatgcacggaacactgcttgggtatcatttgatgggaggaaaagacaagaaatcagccatggagacagtattagcatcactacctcgtgttaccctgtcccttccatctgttttcgggacccagtgaacgactggtttgacagcttggccgagtgcttacattggaacgtgcggaagaagcaaaaccatttcactgaagaggaggaggaagacggggacttttaaggattttcttgtattggaacatgcagtatctgctcccagttacagcaactgttccacttactgcgcttcactcacggacaatagaccaaaacagactgaagcccttatgggaaataccagctgcaaagtactggtcttacttctaaccagcttcctttatttctcaaactagtgttaccttaagattttaaaaaagaaatttataattatttcatataaaattacaatttcaaatattaaccgacctgccgccagcggtgcttacatgaaattacacagttttccgctggtggcaaaagagggttttgtagagttgtttacattttataaatatatgtcccatgcctgataaatcttaaatggattttattttcccttaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MERSQGKVCNKDKSESIEETHFFAACDCEEDFTRGKPIRGRTKSRSLSASPAPGSTKEFRRTRSMHGPCPVTTFGPKACMLQNPKAIMHIQDPASQLLTWNKPPKSVLVIKKVRDASLLKPFKELCVFLTEEKNMIVYVEKKVLEDPAIANDENFGPVKKKFCTFREDYDDISNQIDFIICLGGDGTLLYASSLFQDSVPPVMAFHLGSLGFLTPFNFDNFQTQVTQVIEGNAALVLRSRLKVKVSKEHKEKKTVLQNGVEENGLIVKSEKEPIKQTKYQVLNEVVVDRGPSSYLSNVDVFLDGHLITTVQGDGVIVSTPTGSTAYAAAAGASMIHPNVPAIMITPICPHSLSFRPIVVPAGVELKIMLSPDARNTAWVSFDGRKRQEISHGDSISITTSCYPVPSICFRDPVNDWFDSLAECLHWNVRKKQNHFTEEEEEDGDF
Donor tissue: