ORFeome > MGC89002 – XORFeome 2.0

MGC89002 – XORFeome 2.0

General Information

Species: Xenopus tropicalis cystathionine-beta-synthase, mRNA (cDNA clone MGC:89002 IMAGE:7004270), complete cds
Gene Symbol: MGC89002
Gene ID: 493533
ORF gb_acc: MG134157
ORF ID: 11790

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082489

Library Location

Plate ID: GDExt11017
Well Location: E04

EST Sequences

Clone: MGC:89002 IMAGE:7004270
Trimmed Sequence: ATGCCGGCTGTGCCACCCACCACTGATTCTGCCTCCTGCCCTCACCATAAGGAAAGCCATGCGACCAATGGCAACGTGAAGGCGGAGCTTAGTGCAGACAGGAAATGGATTCGGCCAGACTTGCCCAGCAAGTGCACCTGGCAACTGGGAAAGGCCCAGAGCGACTCGCCCCATCACCACGTGGAACTGAGTGAGCGGCCCCGGATCCTGCCCAGTATCCTGCAGAAGATCGGGGACACCCCGCTGGTTCGGATCAATCAGATCGGGAGGAGATTTGGGCTGAAGTGCGAACTGCTGGCCAAGTGTGAGTTCTTTAACGCGGGGGGCAGCGTGAAGGATCGGATCAGCCTGCGCATGGTGGAAGATGCCGAGAGAGATGGAATCCTCAAGCCGGGAGACACCATCATTGAGCCGACGTCTGGGAATACTGGAATCGGATTGGCCCTGGCAGCGGCAGTAAAGGGGTACCGCTGTATCATTGTGATGCCGGAGAAGATGAGTATGGAGAAGGTGGACGTGCTTCGTGCCCTCGGGGCTGAGATTGTTCGGACCCCCACAAACGCCCGCTTTGATTCGCCGGAGTCCCACGTGGGGGTTGCTTGGCGGCTGAAGAACGAGATCCCAAATTCCCATATTCTGGATCAGTATCGGAATGCCAGTAACCCCCTCGCTCATTATGACAGTACAGCCGAGGAGATCCTCCAGCAGTGCGAGGGGCAGTTGGACATGTTGGTCGCCGGCGCTGGAACTGGAGGAACAATCACCGGTCTCGCTCGCAAACTTAAAGAGAAATGTCCCAACTGTAAGATCGTGGGAGTGGATCCCGAAGGTTCTATCCTGGCGGAACCCGAGGAACTCAACCTGACGGATAAGACTGGGTACGAGGTCGAGGGGATCGGATACGACTTCATTCCTACTGTGCTGGATCGGACGGTGGTGGATGAATGGTACAAGTCTAATGACGAGGAATCGTTCTTTATGTCGCGAGCGTTAATCCGAGAGGAGGGGCTGTTATGCGGGGGCAGTTCTGGCAGCGCCATGTCGGCGGCAGTAAAAGCGGCCAAGGAACTGAGCGAGGGGCAACGCTGCGTGGTGATCCTGCCCGACTCTGTACGGAATTACATGTCCAAGTTCCTCAGTGACAAGTGGATGACCCAGAAGCAGTTCCTGAAGGTGGAGGAGCTGGAGGAGAGGAAACCTTGGTGGTGGAACCTGAAGGTCTCGTCTCTGTCTCTCTCCGCTCCCCTGACCGTCCTGCCGACAGTGAGCTGCGGCCAAACCATCCAGCTGCTGCGAGACAAGGGCTTCGACCAGGTGCCCATCGTGTCCGAGACCGGGCTGGTTCTGGGGATGGTGACGCTGGGGAACATGCTCTCCTCGGTTCTTGCTGGGAAAGTGAAACCATCAGATCCGGTCACTAAAGTCATCTACAAGCAGTTCTCCCAGGTGAATCTGAAGGACAACCTCGGAAAGCTTTCCCGCATTCTGGAGACGGATCATTTTGCTTTAGTTCTTCACGAGCAGATTCAGTATCACAGCGACGGCTCGTCCAGTAAGAAGCAGATGGTTTTTGGGGTGGTGACCGCCATCGATCTGCTGAATTTCATTACCAGAGAGCGGGAGCGGCGCGTGAGTGAATCCGGGGAGAAGGATCTGGTGGAACGAGTCCGGCACTTCAGTGCATCGTAA
Full Trace Sequence: ctcctactgagtgattgggggtgggggtcattatgccggctgtgccacccaccactgattctgcctcctgccctcaccataaggaaagccatgcgaccaatggcaacgtgaaggcggagcttagtgcagacaggaaatggattcggccagacttgcccagcaagtgcacctggcaactgggaaaggcccagagcgactcgccccatcaccacgtggaactgagtgagcggccccggatcctgcccagtatcctgcagaagatcggggacaccccgctggttcggatcaatcagatcgggaggagatttgggctgaagtgcgaactgctggccaagtgtgagttctttaacgcggggggcagcgtgaaggatcggatcagcctgcgcatggtggaagatgccgagagagatggaatcctcaagccgggagacaccatcattgagccgacgtctgggaatactggaatcggattggccctggcagcggcagtaaaggggtaccgctgtatcattgtgatgccggagaagatgagtatggagaaggtggacgtgcttcgtgccctcggggctgagattgttcggacccccacaaacgcccgctttgattcgccggagtcccacgtgggggttgcttggcggctgaagaacgagatcccaaattcccatattctggatcagtatcggaatgccagtaaccccctcgctcattatgacagtacagccgaggagatcctccagcagtgcgaggggcagttggacatgttggtcgccggcgctggaactggaggaacaatcaccggtctcgctcgcaaacttaaagagaaatgtcccaactgtaagatcgtgggagtggatcccgaaggttctatcctggcggaacccgaggaactcaacctgacggataagactgggtacgaggtcgaggggatcggatacgacttcattcctactgtgctggatcggacggtggtggatgaatggtacaagtctaatgacgaggaatcgttctttatgtcgcgagcgttaatccgagaggaggggctgttatgcgggggcagttctggcagcgccatgtcggcggcagtaaaagcggccaaggaactgagcgaggggcaacgctgcgtggtgatcctgcccgactctgtacggaattacatgtccaagttcctcagtgacaagtggatgacccagaagcagttcctgaaggtggaggagctggaggagaggaaaccttggtggtggaacctgaaggtctcgtctctgtctctctccgctcccctgaccgtcctgccgacagtgagctgcggccaaaccatccagctgctgcgagacaagggcttcgaccaggtgcccatcgtgtccgagaccgggctggttctggggatggtgacgctggggaacatgctctcctcggttcttgctgggaaagtgaaaccatcagatccggtcactaaagtcatctacaagcagttctcccaggtgaatctgaaggacaacctcggaaagctttcccgcattctggagacggatcattttgctttagttcttcacgagcagattcagtatcacagcgacggctcgtccagtaagaagcagatggtttttggggtggtgaccgccatcgatctgctgaatttcattaccagagagcgggagcggcgcgtgagtgaatccggggagaaggatctggtggaacgagtccggcacttcagtgcatcgtaatgtggaggggaacgtccccctcgttatgtacaatcagcctttctttctgtgctgcccatctttttgtctcctcccacctgctgttacctgctgttacctgtcagaccgtaggtcagttttaattggctgttacataattgattttgccactcaactgcacttcataaattaaaggtcattgtgcatagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPAVPPTTDSASCPHHKESHATNGNVKAELSADRKWIRPDLPSKCTWQLGKAQSDSPHHHVELSERPRILPSILQKIGDTPLVRINQIGRRFGLKCELLAKCEFFNAGGSVKDRISLRMVEDAERDGILKPGDTIIEPTSGNTGIGLALAAAVKGYRCIIVMPEKMSMEKVDVLRALGAEIVRTPTNARFDSPESHVGVAWRLKNEIPNSHILDQYRNASNPLAHYDSTAEEILQQCEGQLDMLVAGAGTGGTITGLARKLKEKCPNCKIVGVDPEGSILAEPEELNLTDKTGYEVEGIGYDFIPTVLDRTVVDEWYKSNDEESFFMSRALIREEGLLCGGSSGSAMSAAVKAAKELSEGQRCVVILPDSVRNYMSKFLSDKWMTQKQFLKVEELEERKPWWWNLKVSSLSLSAPLTVLPTVSCGQTIQLLRDKGFDQVPIVSETGLVLGMVTLGNMLSSVLAGKVKPSDPVTKVIYKQFSQVNLKDNLGKLSRILETDHFALVLHEQIQYHSDGSSSKKQMVFGVVTAIDLLNFITRERERRVSESGEKDLVERVRHFSAS
Donor tissue: