ORFeome > MGC89071 – XORFeome 2.0

MGC89071 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89071 protein, mRNA (cDNA clone MGC:89071 IMAGE:7005894), complete cds
Gene Symbol: MGC89071
Gene ID: 493539
ORF gb_acc: MG134106
ORF ID: 11730

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082496

Library Location

Plate ID: GDExt11017
Well Location: H04

EST Sequences

Clone: MGC:89071 IMAGE:7005894
Trimmed Sequence: ATGCACACTCTGATCCGATCTTTTCTGGGTCTATGGTATGTCTTGGGAGCATTAGCTCAGACAGAAATCAAGCTTGTTGCAGATGAGAATGTGACACTTCCCTGCCGCCATAGCCTCGGACACCTTGGGATACAGAGCTTGGACATTGAGTGGCTTTCAAACATTTCTGATCATGGAAAGCAAGTTCTGCTCAGTTACAGTGGAGGACAGGTCTACAATGCAGAAAACCACAAGGGACGTTACAGCTTCGTGTCCAAATATCTAGAAGGAGATGCTTCACTGTTCATCAGATCTCTGCAGCCCAGTGATGCGGGACAGTACATTTGCAAAGTCAAAAATGCAGGGCAATATCAGTGGAGTTTTATTACAGTAATTGTTTTAGTTAAACCTTCGGAACTAGCATGTAGCTCAGAAGGAGCACAACTTGAGGGAAAAAATGTGACACTGAATTGCAAGTCAACAGCTGGCACAAAACCCCTGAACTACCGCTGGGTCCGGGTGAATCTCAAAGATAATGTAGAAAGGCCTGTGCAGAGTACAGCACGCATCGGGCCAGAAAATCAACTGCTGTTACATAATTTAAGTAAAACAGACAATGGATCCTATCGATGTGAGGTGTCTAATGAAGTAGGGAAGCGGACCTGTGATGTAGATGTAACAGTGCAGAGTGTGAGCAACACAGGAATTTTAGCAGGTGTCGCCTGTGGAGTAGTGGTTGGTGTGTTCCTTATTTTCTTCACGGTCTGGCTGCTGTTTCATAAAAAGGAGTTTAAGAAAAGAGAAGAGGAAGAATTCTTTAATGAAATCAGGGAAGATGCTGAAGCCCCAAAAGCTCGACTTGTAAAACCTGGGTCATCTTCCTCAGACTCCAGAAGCTCTCAGTCAGGTTCTTCATCTACCAGGTCTACAACAAACAGTGCCTCTCGGAGTCAAAGGACTCATTCCACACAGGAAACTCCCCATGGTGAGCAAAGACATCATTGTCTGGAGAAGATATAG
Full Trace Sequence: gctgctcttacagaaaaaagctacatttagactttattttgttttgaaacgtttcctgtacaactcatttctgtaggtggggattggttaagttgtggatagcaatccaggggcagaagaaagttgcttctagggttgccacatggaggtaattatgtttcttgcattccacagactgtgatgctcccccatgcagggctgactgccaatccagcaggaaaccaatgttcagccttgtgccttccactctgccccatctcgctatcccaggacttcttctggactaatgaacaaagatgcacactctgatccgatcttttctgggtctatggtatgtcttgggagcattagctcagacagaaatcaagcttgttgcagatgagaatgtgacacttccctgccgccatagcctcggacaccttgggatacagagcttggacattgagtggctttcaaacatttctgatcatggaaagcaagttctgctcagttacagtggaggacaggtctacaatgcagaaaaccacaagggacgttacagcttcgtgtccaaatatctagaaggagatgcttcactgttcatcagatctctgcagcccagtgatgcgggacagtacatttgcaaagtcaaaaatgcagggcaatatcagtggagttttattacagtaattgttttagttaaaccttcggaactagcatgtagctcagaaggagcacaacttgagggaaaaaatgtgacactgaattgcaagtcaacagctggcacaaaacccctgaactaccgctgggtccgggtgaatctcaaagataatgtagaaaggcctgtgcagagtacagcacgcatcgggccagaaaatcaactgctgttacataatttaagtaaaacagacaatggatcctatcgatgtgaggtgtctaatgaagtagggaagcggacctgtgatgtagatgtaacagtgcagagtgtgagcaacacaggaattttagcaggtgtcgcctgtggagtagtggttggtgtgttccttattttcttcacggtctggctgctgtttcataaaaaggagtttaagaaaagagaagaggaagaattctttaatgaaatcagggaagatgctgaagccccaaaagctcgacttgtaaaacctgggtcatcttcctcagactccagaagctctcagtcaggttcttcatctaccaggtctacaacaaacagtgcctctcggagtcaaaggactcattccacacaggaaactccccatggtgagcaaagacatcattgtctggagaagatatagcaggagatggctgggctacaagaaaaatacatttacttttcaaagcaacataataaagccattttctctactaacctggacgtgattttacgaagatattggggttacatgcacattatttaaaacaaaaaacttttgagtaggctggttgacttcattttatctctcacttttgaacttttttacaacttggagctctacagtattacatatattggaaacggtaccaaaaagttacacctatgttctaactttcaataatatgatgtatttatggagaacctagatgaaagtacaaagtggaatgtgaacaataagcaagatgctttgaatgcattttcatatttgaacaatttgtcactggaggacttcaaagaggcaacaacttgataaagcattgggatgaaatcattgtgaatggttttataagggaaaacacaaaaatcttattttataataaaagaacaaattgatattacaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MHTLIRSFLGLWYVLGALAQTEIKLVADENVTLPCRHSLGHLGIQSLDIEWLSNISDHGKQVLLSYSGGQVYNAENHKGRYSFVSKYLEGDASLFIRSLQPSDAGQYICKVKNAGQYQWSFITVIVLVKPSELACSSEGAQLEGKNVTLNCKSTAGTKPLNYRWVRVNLKDNVERPVQSTARIGPENQLLLHNLSKTDNGSYRCEVSNEVGKRTCDVDVTVQSVSNTGILAGVACGVVVGVFLIFFTVWLLFHKKEFKKREEEEFFNEIREDAEAPKARLVKPGSSSSDSRSSQSGSSSTRSTTNSASRSQRTHSTQETPHGEQRHHCLEKI
Donor tissue: