ORFeome > MGC89251 – XORFeome 2.0

MGC89251 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89251 protein, mRNA (cDNA clone MGC:69553 IMAGE:5378974), complete cds
Gene Symbol: MGC89251
Gene ID: 448372
ORF gb_acc: MG133357
ORF ID: 10860

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074627

Library Location

Plate ID: GDExt11009
Well Location: G03

EST Sequences

Clone: MGC:69553 IMAGE:5378974
Trimmed Sequence: ATGGCTGAGTGTTCCACGCTGGAGAGTCTCATTGAGATGGGATTTTCACCCAGTAGAGCGGAGAAGGCATTGGCTGCTACTGGCAATCAGGGAATAGAACCAGCTATGGACTGGTTAGTAGAACATGAAGATGATCCTGATATTGATGAACCAAGTGTGGTTGTCCCTGAAGATAGTGATTCTGGTACAACAGATACACAAGGCATGGACACCTGTGAAGAAAGACTTCCCCTGACTGAAGAGGAGAAAGAGAAACAGACAAAGAGGATGATGGAACTGATTGCCCAGAAGCAGAAAGAGCGAGAAGAAAGAGAGAAGAGGGAAAGGATTGAACAGGAAAAGCAGCGACGGAAGCAAGGTCAAGAATTGTCTGCAGTCAAGCAGAAAATACAAGAACAAGAGATGCAGAAAGCTGTTGAAGACAGAAGAAGAGAAAAACAAGAAGAGAAGCTGGCAAGGGATAGAGTCCGGGAAAAAATTGCACGAGATAAAGCTGAGAGAGCTAGAAGGTTTGGAGGAGCAGGTTCAGAACCGATCTCGCCTCCAGCAGAGGCCTCTATTCCTGCTACCACCCCATCCCCATCTTCCCCAGTACAAGAGCCGCCCACTAAGAAGGAATATGATCAGTGCCGTATTCAGGTGCGTCTGCTTGATGGATCTGCCTTATCCCAGACTTTCCGTGCTCGAGAGCAGCTAGCGGCGGTGCGTCTGTATGTGGAGCTGAACTGGCCTGGGGGTGCCCCGGGGCCTTTCAATCTCCTCACAAGCTTCCCAAGAAGAGTCTTCACAGAAGAGGACATGGAAAAGCCCTTGCAAGAACTTGGTTTGGTGCCTAGTGCAGTCCTAATTGTTGCCAGAAAATAA
Full Trace Sequence: cacgccggaagagccgaatgcgggaaagatcaggagctacgggagcagttcgggcaatgtggggaatgtaaacaatacactgggacagccagctgccttatgttaatcgggctgtcccgtgaaaagctgccaacttgggagagatggctgagtgttccacgctggagagtctcattgagatgggattttcacccagtagagcggagaaggcattggctgctactggcaatcagggaatagaaccagctatggactggttagtagaacatgaagatgatcctgatattgatgaaccaagtgtggttgtccctgaagatagtgattctggtacaacagatacacaaggcatggacacctgtgaagaaagacttcccctgactgaagaggagaaagagaaacagacaaagaggatgatggaactgattgcccagaagcagaaagagcgagaagaaagagagaagagggaaaggattgaacaggaaaagcagcgacggaagcaaggtcaagaattgtctgcagtcaagcagaaaatacaagaacaagagatgcagaaagctgttgaagacagaagaagagaaaaacaagaagagaagctggcaagggatagagtccgggaaaaaattgcacgagataaagctgagagagctagaaggtttggaggagcaggttcagaaccgatctcgcctccagcagaggcctctattcctgctaccaccccatccccatcttccccagtacaagagccgcccactaagaaggaatatgatcagtgccgtattcaggtgcgtctgcttgatggatctgccttatcccagactttccgtgctcgagagcagctagcggcggtgcgtctgtatgtggagctgaactggcctgggggtgccccggggcctttcaatctcctcacaagcttcccaagaagagtcttcacagaagaggacatggaaaagcccttgcaagaacttggtttggtgcctagtgcagtcctaattgttgccagaaaataaaaccgcacatgaattgtaaccacctgaaaacgtgaaatgcagtgtgctccccagaagagcacagactgtaggagaggcctctctccctggaaagacaacacacggactgttcttcacgcatctccctgaggtgtactgtagtgtgtgcgtgtgttcagagggagaaataaaccagtgtgatatgaacatccactcttctggatacacggttattctgatgtaaaatgatctgctctgctaaaagttgagtcccttctattaaatattatcaacttttacagagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAECSTLESLIEMGFSPSRAEKALAATGNQGIEPAMDWLVEHEDDPDIDEPSVVVPEDSDSGTTDTQGMDTCEERLPLTEEEKEKQTKRMMELIAQKQKEREEREKRERIEQEKQRRKQGQELSAVKQKIQEQEMQKAVEDRRREKQEEKLARDRVREKIARDKAERARRFGGAGSEPISPPAEASIPATTPSPSSPVQEPPTKKEYDQCRIQVRLLDGSALSQTFRAREQLAAVRLYVELNWPGGAPGPFNLLTSFPRRVFTEEDMEKPLQELGLVPSAVLIVARK
Donor tissue: tailbud