ORFeome > MGC89288 – XORFeome 2.0

MGC89288 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89288 protein, mRNA (cDNA clone MGC:89288 IMAGE:6978847), complete cds
Gene Symbol: MGC89288
Gene ID: 448384
ORF gb_acc: MG133805
ORF ID: 11377

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075471

Library Location

Plate ID: GDExt11013
Well Location: G03

EST Sequences

Clone: MGC:89288 IMAGE:6978847
Trimmed Sequence: ATGGTGGGAGACCAGACGGACCCAGACACTGTCTTTCTCTGTGGTGAAAGCCGACAATTTATTCAGTTTCTCATATTTGGCATCTTGTTTGTCTCCTCTGGCATTCTCATTAGTGTGCTGGGGGTTTGGATTCCTGGATGCGGTTTAGGGTTGCCGCACCACAATGTCAATGGGACCGTGTCTGACTACAAAACCTGTGGATTCCTTTCTCTTCAAATAATGGGACCTTTGATTGTGCTGCTGGGGCTCTGCTTCTTTGTGGTAGCTCATGTAAAGAAACGGCATAACAGCAGTGAAAGAGATGACTCCACCACAGAGGATGAGCCACAGACACCAACAGATGAGCCCTTTCACATTACTGTTGGAGATTCTGTAATACTGTTTCCGCCCCCACCTCCACCGTATTTTTTGGATCCTTCATCACAAACCGCACACCATGGGGGTAACCCATTGCCCAGGAGTGAGAACCCACCTTCTTATAACAGTATTTTTAATACAAGAGTACGTATTAATGGACAAGACAGTCTCACAGTCCGGGATACAGTGTATACCATTTCTTTGCCAAGTACTTCTGAGGGCTATACCAACCCTTCCTTCTTACCTGAGCCACCACCGAAGTATGAAGAGAAAGATCCTTGCCCTACAGGACCTACTGATGCTTCATCTCCGGTGTCCTCTGCTGAACCAGCCTTGCCTCCTCAAATTCCACCCTATGAAGAACTTGAATAG
Full Trace Sequence: acttgatagcgctccgtactcgggggattcttgtactctctctgccccaggtaccatagagttctcttcagacgaaagcaaaaccaattttgaagtggcaaagatttctctttcacaatgcagcccccatttttctccttctcctttcggcctctaagttcgggccacgccagcagactcatatttttcctctttgtttttggagttgtagtgttctgtgcgggattcctcctttccatctttggtttccagtcctgtacttcagataccctctccagctgcaatgtcaccttcaaagtagtcggtcctgcccttgctgtagtagggctggcatcggtcttgatggcgagatctagagctaggctggaagtcaggagaagagaaatggtgggagaccagacggacccagacactgtctttctctgtggtgaaagccgacaatttattcagtttctcatatttggcatcttgtttgtctcctctggcattctcattagtgtgctgggggtttggattcctggatgcggtttagggttgccgcaccacaatgtcaatgggaccgtgtctgactacaaaacctgtggattcctttctcttcaaataatgggacctttgattgtgctgctggggctctgcttctttgtggtagctcatgtaaagaaacggcataacagcagtgaaagagatgactccaccacagaggatgagccacagacaccaacagatgagccctttcacattactgttggagattctgtaatactgtttccgcccccacctccaccgtattttttggatccttcatcacaaaccgcacaccatgggggtaacccattgcccaggagtgagaacccaccttcttataacagtatttttaatacaagagtacgtattaatggacaagacagtctcacagtccgggatacagtgtataccatttctttgccaagtacttctgagggctataccaacccttccttcttacctgagccaccaccgaagtatgaagagaaagatccttgccctacaggacctactgatgcttcatctccggtgtcctctgctgaaccagccttgcctcctcaaattccaccctatgaagaacttgaatagaagctgaaatggatcgcatggttttttttacagactgttttagtggtagagagaaactttcacaacagaatgccagaggaacatgggacatctgttccatgagggcttaagaatctaaaattgatacctgagcaatggtaaagtgctgctaactgttcttgtagaaatatgaaatgttatctgatgatatcactttggcaaagaatcaggtggctcactggcaaggggccatatttgttgctgtcagtaagatactgaggatggaaattgtgtatgtccagtatctggacaattataaatttgtacaaatactttactatttaaattgcagcttagaaatttgatgaaattgggaacttgtatttccatgtgtgaaattttaatttgctactgaaacaacacgctaatgcatagtattcatgttttaagacttgttttctctaagtgtaagagaaaattaattttaccaacatttttccactgaaattatttttaacaaatgtttttgaataaatattaattcacctgaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVGDQTDPDTVFLCGESRQFIQFLIFGILFVSSGILISVLGVWIPGCGLGLPHHNVNGTVSDYKTCGFLSLQIMGPLIVLLGLCFFVVAHVKKRHNSSERDDSTTEDEPQTPTDEPFHITVGDSVILFPPPPPPYFLDPSSQTAHHGGNPLPRSENPPSYNSIFNTRVRINGQDSLTVRDTVYTISLPSTSEGYTNPSFLPEPPPKYEEKDPCPTGPTDASSPVSSAEPALPPQIPPYEELE
Donor tissue: tailbud