ORFeome > MGC89303 – XORFeome 2.0

MGC89303 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89303 protein, mRNA (cDNA clone MGC:89303 IMAGE:6982443), complete cds
Gene Symbol: MGC89303
Gene ID: 448389
ORF gb_acc: MG133824
ORF ID: 11399

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075477

Library Location

Plate ID: GDExt11014
Well Location: A02

EST Sequences

Clone: MGC:89303 IMAGE:6982443
Trimmed Sequence: ATGGGCCGCCGACCTGCCCGCTGTTACAGATACTGCAAGAACAAGCCGTACCCCAAATCCCGTTTCTGTAGAGGAGTCCCAGATCCCAAAATCCGCATCTTTGACTTGGGGCGCAAGAAAGCAAAGGTGGATGAGTTCCCATTGTGTGGTCACATGGTATCTGATGAATATGAACAGCTCTCTTCAGAAGCTCTGGAAGCTGCCCGTATCTGTGCCAACAAGTACATGGTGAAGAGCTGCGGCAAGGATGGCTTCCACATCCGGGTTCGCCTGCATCCTTTCCATGTCATCAGAATCAACAAGATGTTATCATGTGCCGGTGCTGACAGACTTCAGACCGGAATGCGTGGTGCTTTTGGCAAACCCCAGGGCACAGTGGCACGTGTGCACATTGGTCAAGTGATCATGTCTATCCGCACCAAGACCCAAAATAAGGAGCATGTGATTGAAGCTTTACGCCGAGCCAAGTTCAAGTTCCCTGGGCGTCAGAAGATTCACATTTCTAAGAAATGGGGTTTTACCAAGTTCAACGCTGACGAGTTTGAGTCTCTGCTTGCGGAGAAGCGGCTGATCCCTGACGGCTGTGGGGTGAAGTACATTCCCAACAGGGGCCCCCTGGACAAATGGAGAGCAATTCATGCTGTTTAG
Full Trace Sequence: ggcgaggtgcagccgccatcatgggccgccgacctgcccgctgttacagatactgcaagaacaagccgtaccccaaatcccgtttctgtagaggagtcccagatcccaaaatccgcatctttgacttggggcgcaagaaagcaaaggtggatgagttcccattgtgtggtcacatggtatctgatgaatatgaacagctctcttcagaagctctggaagctgcccgtatctgtgccaacaagtacatggtgaagagctgcggcaaggatggcttccacatccgggttcgcctgcatcctttccatgtcatcagaatcaacaagatgttatcatgtgccggtgctgacagacttcagaccggaatgcgtggtgcttttggcaaaccccagggcacagtggcacgtgtgcacattggtcaagtgatcatgtctatccgcaccaagacccaaaataaggagcatgtgattgaagctttacgccgagccaagttcaagttccctgggcgtcagaagattcacatttctaagaaatggggttttaccaagttcaacgctgacgagtttgagtctctgcttgcggagaagcggctgatccctgacggctgtggggtgaagtacattcccaacaggggccccctggacaaatggagagcaattcatgctgtttagattctacttctagcagagcctctctcccaataaaacctattggatgttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGRRPARCYRYCKNKPYPKSRFCRGVPDPKIRIFDLGRKKAKVDEFPLCGHMVSDEYEQLSSEALEAARICANKYMVKSCGKDGFHIRVRLHPFHVIRINKMLSCAGADRLQTGMRGAFGKPQGTVARVHIGQVIMSIRTKTQNKEHVIEALRRAKFKFPGRQKIHISKKWGFTKFNADEFESLLAEKRLIPDGCGVKYIPNRGPLDKWRAIHAV
Donor tissue: tadpole