ORFeome > MGC89312 – XORFeome 2.0

MGC89312 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89312 protein, mRNA (cDNA clone MGC:89312 IMAGE:6986540), complete cds
Gene Symbol: MGC89312
Gene ID: 493467
ORF gb_acc: MG133811
ORF ID: 11384

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC081307

Library Location

Plate ID: GDExt11013
Well Location: F10

EST Sequences

Clone: MGC:89312 IMAGE:6986540
Trimmed Sequence: ATGAGGCTGCTCAGCACTCTGCTCTTCTTGGTGGCTGCCACTTGCCCCCTGATCCATGCCACGCTCTCCAAGACAGACTCCAAGAAAGCGGCTTCCAAAGCACCTGAGACCAAGACTCGTCTGTCTGACACCTTGGTACAGACCCGTGGGCTGGTTTCCACTGACGTCAAAGCTAAGGACATTGTGCTGGAACACAGGAGTTACTGTGCCAAGAAGCTGAAGGAGAGGCACGTCTCTGCTGATGTACTGGGATATGTCACGCCATGGAACGGCCATGGCTACGATATCGCCAAGACATTTGCGGCCAAATTTACCCTCATTTCTCCAGTTTGGCTGCAGATAAAGAGGAAAGGCAAAGAGGCCTATCACATTACTGGGCTTCATGATGTAGATCAAGGATGGATAAAGGACATTAGGAAGACGTCCAAGAGCACTCAGATTGTTCCACGCATCCTATTTGATGGTTGGTCTTATCAGGACTTTGAGAGTGTGTTCAGCAGCGAAGATGAGATAGAAGAGCTTGCCGGTGCCATGGTGCAGACTGCAAAGGATGAGCGCTTTGACGGCTTCGTAGTGGAGGTTTGGAGTCAACTGGGCGGGCAGAAGCGGCAGGAGCTGGTTCACCTGCTGACACACATCGGGGAAGCCCTGCGCTTGGCAAAGCTCCGCTTTATCCTTGTTATTCCTCCTGCTCTAGCTCCAGGCACTGATCATTTGGGCATGTTTGGGAGGAAAGAGTTTGACCAGTTGGCGCCTGTTGTGGACAGCTTCAGCCTCATGACATATGACTATTCAAGTCCCCAAAGACCTGGCCCTAATTCGCCCATCACCTGGGTACAAGCATGCATACAGCTACTGGATCCTGAATCCAAATGGAGAAAGAAAATCCTGCTGGGGTTACACTTTTATGGAATGGATTACTCTGCGCTTGGTGCATCCGGGGAGCCCATCCTAGGAAACAGATACATTGAGATCCTGAAGGAGCACAAGCCAAAGCTTCTGTGGGACCAACAAATAGCTGAACATTACTTGGAATATAAAAAAAACAAAGGTGGAAAACATGCTGTTTTTTTCCCAACACTGAAGTCTATACAAGTACGCCTGGATCTTGCTGAAGAACTGGGCACCGGAATATCCATCTGGGAACTGGGCCAAGGGTTGGACTATTTCTACGACCTTCTATGA
Full Trace Sequence: ggcaaatggaagcttcttagtctttattcaagcatgttgaatccttgccgttgatgctgactatggctcccagcatcacattggccgcaggtttatttctggtggatgctgagaggtgtagtacgatactagctggagagccacaaaccactggctcttattttctcctgagagtttgagtcagctttgaagccatgaggctgctcagcactctgctcttcttggtggctgccacttgccccctgatccatgccacgctctccaagacagactccaagaaagcggcttccaaagcacctgagaccaagactcgtctgtctgacaccttggtacagacccgtgggctggtttccactgacgtcaaagctaaggacattgtgctggaacacaggagttactgtgccaagaagctgaaggagaggcacgtctctgctgatgtactgggatatgtcacgccatggaacggccatggctacgatatcgccaagacatttgcggccaaatttaccctcatttctccagtttggctgcagataaagaggaaaggcaaagaggcctatcacattactgggcttcatgatgtagatcaaggatggataaaggacattaggaagacgtccaagagcactcagattgttccacgcatcctatttgatggttggtcttatcaggactttgagagtgtgttcagcagcgaagatgagatagaagagcttgccggtgccatggtgcagactgcaaaggatgagcgctttgacggcttcgtagtggaggtttggagtcaactgggcgggcagaagcggcaggagctggttcacctgctgacacacatcggggaagccctgcgcttggcaaagctccgctttatccttgttattcctcctgctctagctccaggcactgatcatttgggcatgtttgggaggaaagagtttgaccagttggcgcctgttgtggacagcttcagcctcatgacatatgactattcaagtccccaaagacctggccctaattcgcccatcacctgggtacaagcatgcatacagctactggatcctgaatccaaatggagaaagaaaatcctgctggggttacacttttatggaatggattactctgcgcttggtgcatccggggagcccatcctaggaaacagatacattgagatcctgaaggagcacaagccaaagcttctgtgggaccaacaaatagctgaacattacttggaatataaaaaaaacaaaggtggaaaacatgctgtttttttcccaacactgaagtctatacaagtacgcctggatcttgctgaagaactgggcaccggaatatccatctgggaactgggccaagggttggactatttctacgaccttctatgattccaaacaagctgcatccaccagggcagtaatagccaaaatatgtccggaaactgcatcatgtgacagaatggacctttaattctttgggggaagcgatgccaaactaaattccagagcaacactgatgtgtgtagcagccttctctggcattcaaggagttagtatgggcaagccttataatggcccagccttgattaatgggtataatttgaaataaccatgttttcagtccattttggatctgttctacaacaaactggtccctatgcctggccagccagcagtaaccatagatcgactctctgactgatcctcctgtccataccaaatgccttagaacctgactgtaacctcagatcttccactctcagcactggagaacttgaatgagctcctttctaatctgaaattcactgttttttttccaaaggttcattaaaaatgagatacatttctctaaaaaaaaaaaaaaaaaa
Translation: MRLLSTLLFLVAATCPLIHATLSKTDSKKAASKAPETKTRLSDTLVQTRGLVSTDVKAKDIVLEHRSYCAKKLKERHVSADVLGYVTPWNGHGYDIAKTFAAKFTLISPVWLQIKRKGKEAYHITGLHDVDQGWIKDIRKTSKSTQIVPRILFDGWSYQDFESVFSSEDEIEELAGAMVQTAKDERFDGFVVEVWSQLGGQKRQELVHLLTHIGEALRLAKLRFILVIPPALAPGTDHLGMFGRKEFDQLAPVVDSFSLMTYDYSSPQRPGPNSPITWVQACIQLLDPESKWRKKILLGLHFYGMDYSALGASGEPILGNRYIEILKEHKPKLLWDQQIAEHYLEYKKNKGGKHAVFFPTLKSIQVRLDLAEELGTGISIWELGQGLDYFYDLL
Donor tissue: gastrula