ORFeome > MGC89323 – XORFeome 2.0

MGC89323 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89323 protein, mRNA (cDNA clone MGC:89323 IMAGE:6987428), complete cds
Gene Symbol: MGC89323
Gene ID: 448397
ORF gb_acc:
ORF ID: 11353

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075486

Library Location

Plate ID: GDExt11013
Well Location: E03

EST Sequences

Clone: MGC:89323 IMAGE:6987428
Trimmed Sequence: ATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCCGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTAAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCACCGTAGTACGGCACTTGCCACGCAGGCTGCCATTTTGTATGTGATTCTCTACTTCCACCCACCAACTCTGCACACTCACCAAGCCAAAATGAGAGAAATAGTGGATAAGTATTTCCCAGATAACTGGGTTATCAGCATCTATATGGGGATCACTGTGAATCTGATGGAAGTGTGGGAGCCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCTTCTGAAGGAGATGTTCAAACAGATGCTGTCAGAGAAGCAAAACAAGTGGGAAAGCTATAAGAAAGAAGGATCAGAAAGAATGACGGAGCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACAACGTAGAACAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGATCCGAAGGTTACGTGTTACATAGATCAGATGAACACGTGGTACGACATGAAAACTCACCAGGAAGTCACTAATAACCACCTCTTCTCAGAGATCAACGATTCACTGGGAACTTTTGGCTTAAATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCGCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGGCCAGGAGACATTACGGGCCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTCCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGA
Full Trace Sequence: gtattgggcgctggataccatggcaacggctctgccctgatgcaatctggggaagaggaagagaccactttctcctcacagcaagggacccctggtttagtagagagatatttccttctgatttgattcttggagctgcggagtgtaagcaagatggttgatttcctggcagaaaataacctgtgcgggcaagccattctgcgcattgtctcccgtggaaacgctatcatagcggaactgttacggctctcggaatttgttcccagtgtgttccgccttaaagacaaagcagatcagcagaagtatggagatatcatattcgattttagttacttcaaggggcctgaggtctgtgaggggagactggaagccaaaccagagctccaggacctggatgaggaattccgtgaaaacaacatagagatactaacaagattttatttggcctttgaaagcgtacacaagtatattgttgatttgaacaggtatttggaggatcttaatgaaggcatttacattcagcaaaccctggaaactgtgcttctcaatgaggacggaaaacagctgctttgtgaggcgctgtacctgtacggtgtgatgctgctggttatagaccagaagatcgaaggggaagtgcgggagaggatgctggtcgcgtattatagatatagcgcagcaagatcctctgtcgattcaaacatggatgatatctgcaagctacttagaagtacaggctactccagccagccaggcgctaaaagacccccaaactaccccgagagctacttcagccgcgtgccaattagtgaaacctttatcagcatggtgattggcagattaagatcagatgatatctataaccaagtgtctgcctatccattgccagagcaccgtagtacggcacttgccacgcaggctgccattttgtatgtgattctctacttccacccaccaactctgcacactcaccaagccaaaatgagagaaatagtggataagtatttcccagataactgggttatcagcatctatatggggatcactgtgaatctgatggaagtgtgggagccctacaaggctgcaaagactgctttgaattacacactggacctgcccaatatcaaggagcaggcttccaggtatgcaaaaatcattgagagcctgcacccccaggttcagcagttcctgaaggagggctttctccgagaggagtttgtactggataacatccccaagctgctgaattgtctgcgggactgcaatgtcgccatccgatggctcatgcttcacacagctgattctgcttatgatccaaacaacaaacggcttcgccaggtaaaagatcaggttcttgctgattccaagtacaaccccaagattctgttccagttgctgctggatactgcacagtttgagttccttctgaaggagatgttcaaacagatgctgtcagagaagcaaaacaagtgggaaagctataagaaagaaggatcagaaagaatgacggagctggcagatgttttctctggcgtcaaacccctcaccagggtagagaaaaatgaacacttgcaagcctggttcagagagatcgccaagcaaattcactccttaaattatgatgattccactgctgctgggaggaagaccgttcagctcatccaggctcttgaagaggtccaagaattccatcagctggagacaaaccttcaggtgtgccagttcttggctgatacccgcaagttcctccatcaaatgatccgcaccattaacattaaagaggaggttctgatcactatgcagattgtgggtgacctctcgtatgcctggcagctgattgacagcttcacagcaatcatgcaagagagtatcagagccaacccgtccatggttaccaagctgagggccactttccttaagctggcctctgcacttgatttgcccttgctacgcatcaatcaggcaaacagccctgacctactcagtgtatcccagtactactcaggagagctggttttctatgtcaggaaggttctgcagatcatcccggagagcatgttcacttccctagccaagatcatcaagttacagacacatgacattatcgaagtgccaacccgattggacaaggacaaactgagagactacgctcagcttggggctagatatgaggttgccaagttgaccaatgccatttcaatctttactgaaggaattctaatgatgaagactacacttgtaggcataatcaaggtggatccaaagcagcttttggaggatgggatcaggaaggagttggttaaaagagttgctgttgctctacacaaagggcttatcttcaactccagagcaaagcccagcgaactgctgccaaagctgaaagacatggctgccaccatggatggattccatcgctccttcgagtacatacaagactacgtcagcatttatggcttgaaaatttggcaggaggaagtatcccgtattgttaattacaacgtagaacaggaatgcaacaacttcctaagaacaaagattcaagactggcagagcatgtatcagtcaactcacatccctattcccaaatttcctcctgtggatgaatcaatgacgtttataggacgtctgtgtcgggaaatcctgagaattactgatccgaaggttacgtgttacatagatcagatgaacacgtggtacgacatgaaaactcaccaggaagtcactaataaccacctcttctcagagatcaacgattcactgggaacttttggcttaaatggcttggacaggttactttgctttatgatagtgaaggaactgcagaacttcatccgcttgtatcagaggttaattctgagggataaaagtggccaggagacattacgggccttacagaaggtagttactccagttaaagggattgtagctaattctgccaaaatatactctgctgccattgcaaaaacccagaaaatctggcctgcttatcttgatgctataatgaaggttggacagatgcaagtgttaagacaacagattgccaatgagttaaactactcgtgtaaatttgactctaagcacctggcaggagccctagagaactttaatgaagccatattggctgacatacaagcccactaccaggacccgagccttccctgcccacgagaagacaacacgctcctatatgagatcactgcatacctggaagcagctgggacacacaaccccttgaacaaaatttacattactaccaagcagctctctttcttccctattgtgaatttcctgttcctggtcgcccagttgccaaagctgcagtataacaagaacctaggaatgacatgcaggaagccggcagatccgattgattgggttccattggtactcggcctgctaacactgctcaagcagttccattcccgttacactgagcagtttctggccctgatagggcaatttatccgttcgtcattggaacaaagcaccagccagaagatcccagaaatgccggctgatgttgtgggtgcacttatgtttcttgaagattatgttcattttgctaaactgccaagaagggttgtcgaagcacatgtgcctaatttcatttttgatgaattccggacgatacagtgacccccagggtgaacggctatttgggaggggctgaaaaaatgaagtacggatttactaactctgggatgtgcaactttgcaaatgagcaaatggcatttattaaggggttgcacctagtgccgatgtgctaggtgcccatattaatgtggcacattgtggcacaatgaggaagtctattgctattggctaggcactgaatacaggttttcttttgctcacacacaacaatagtacatagtactgtaaatctaatcacatcgttctattgaccagccttgatgcctatgtgtgggacttcacaatttatattgtaggtcagttctccctagcttttcccagatattgcactaaatatacatagttgaatttaaatgtcatacacagttggaggccttggggaatactgcggagcataaaaatacattggacacctgtatccagcccataggcctccagttgggcagctctgtaatagataatatgcacattctgcagcagatgatttaatattgcactcatttatgtttagattcttgttcatagatgtgagggatacatcatttttcatgatcttgtcctttaaatacatctcttttcagtaataaaatgaatacttgttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVDFLAENNLCGQAILRIVSRGNAIIAELLRLSEFVPSVFRLKDKADQQKYGDIIFDFSYFKGPEVCEGRLEAKPELQDLDEEFRENNIEILTRFYLAFESVHKYIVDLNRYLEDLNEGIYIQQTLETVLLNEDGKQLLCEALYLYGVMLLVIDQKIEGEVRERMLVAYYRYSAARSSVDSNMDDICKLLRSTGYSSQPGAKRPPNYPESYFSRVPISETFISMVIGRLRSDDIYNQVSAYPLPEHRSTALATQAAILYVILYFHPPTLHTHQAKMREIVDKYFPDNWVISIYMGITVNLMEVWEPYKAAKTALNYTLDLPNIKEQASRYAKIIESLHPQVQQFLKEGFLREEFVLDNIPKLLNCLRDCNVAIRWLMLHTADSAYDPNNKRLRQVKDQVLADSKYNPKILFQLLLDTAQFEFLLKEMFKQMLSEKQNKWESYKKEGSERMTELADVFSGVKPLTRVEKNEHLQAWFREIAKQIHSLNYDDSTAAGRKTVQLIQALEEVQEFHQLETNLQVCQFLADTRKFLHQMIRTINIKEEVLITMQIVGDLSYAWQLIDSFTAIMQESIRANPSMVTKLRATFLKLASALDLPLLRINQANSPDLLSVSQYYSGELVFYVRKVLQIIPESMFTSLAKIIKLQTHDIIEVPTRLDKDKLRDYAQLGARYEVAKLTNAISIFTEGILMMKTTLVGIIKVDPKQLLEDGIRKELVKRVAVALHKGLIFNSRAKPSELLPKLKDMAATMDGFHRSFEYIQDYVSIYGLKIWQEEVSRIVNYNVEQECNNFLRTKIQDWQSMYQSTHIPIPKFPPVDESMTFIGRLCREILRITDPKVTCYIDQMNTWYDMKTHQEVTNNHLFSEINDSLGTFGLNGLDRLLCFMIVKELQNFIRLYQRLILRDKSGQETLRALQKVVTPVKGIVANSAKIYSAAIAKTQKIWPAYLDAIMKVGQMQVLRQQIANELNYSCKFDSKHLAGALENFNEAILADIQAHYQDPSLPCPREDNTLLYEITAYLEAAGTHNPLNKIYITTKQLSFFPIVNFLFLVAQLPKLQYNKNLGMTCRKPADPIDWVPLVLGLLTLLKQFHSRYTEQFLALIGQFIRSSLEQSTSQKIPEMPADVVGALMFLEDYVHFAKLPRRVVEAHVPNFIFDEFRTIQ
Donor tissue: gastrula