ORFeome > MGC89325 – XORFeome 2.0

MGC89325 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89325 protein, mRNA (cDNA clone MGC:89325 IMAGE:6987488), complete cds
Gene Symbol: MGC89325
Gene ID: 448398
ORF gb_acc: MG133808
ORF ID: 11381

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075487

Library Location

Plate ID: GDExt11013
Well Location: F07

EST Sequences

Clone: MGC:89325 IMAGE:6987488
Trimmed Sequence: ATGGCACAGATTCAGCAAGTTGGAGCTCCAGAGGAGAAGGAGAAGACAACTGCCTTAAAGGATCTGCTTTCAAGAATAGATTTGGATGAACTGATGAAAAAGGATGAGCCACCACTTGAGTTTCCTGATACATTGGAAGGATTTAACTATGCCTTTAACGAATTGGGACAACTAAGACACATTCAGACCGGAGATCCATTTGTCTTCAATTATCGGGAAGATTTACACAGATGGAACCAAAAGCGTTATGAAGCCCTTGGAGAGATTATCACAAAGCATGTCTATGAATTGCTGGAGAAGGACTGTGAACTAGAGAAAGTATATTTGCCGGTAGATGCTACTGACAGCGAGCCAAGGAGTTTTATTTTTATGAGCAAAGATGCAATGACGAATCCAGACAAAATGTTAGTTTTAATACATGGAAGCGGTGTTGTGCGAGCTGGACAGTGGGCACGGAGACTTATAATAAATGAAGATCTGAACAGCGGTTCACAGATACCTTATATCAAAAGAGCAATGAAAGAAGGCTATGCAGTTATTGTGCTAAATCCTAATGAAAACTACATTGAAGTGGAAAAAAGCAAAGTCCCAGCAGATCAGCCATCTCCAGACAGTTCTGATGAACCTGCAGAGAAGAGGGAGAGGAGAGAGAGAAATCCAAAGGAAACTAAGAAACGGAGGGACTTCTATGAAAAATACCGGAATCCCCAAAAGGAAAAGGAGACCCTGCAAGTGTACATTAGAGATAATGGCTCTCCAGAAGAACATGCCTTATATGTATGGGACAATTTCATTTCAAAAGCAGCTGCTGAAAATATATTATTTGTTGCCCACAGCTATGGAGGCCTTACATTTGTAGAACTGATGATTCAACGCGAAGCTGATGTGAAAAATAAAGTTGCTGCTGTGGCTCTGACAGATTCTGTGCATAATGTGTGGCATCAGGATGCAAGTAAAACGCTTCGAGAATGGATGCGAGAGAACTGCTGTAATTGGGTGTCCAGCAGCGAACCTTTGGACACATCAGTGGAATCGACATTACCAGACTGCCCACGTGTATCAGCAGGAACCGAGCGCCATGAGTTGACCTCTTGGAAGAGTTTCCACTCCATCTTCAAGTTTTTTGACGACGCCCTACAAGCGAAGAACACAAAAACCAAGCCAACACCGACCCGGCGCTCTAACAGAATAAAGCATGAAGATCTGTAA
Full Trace Sequence: ggctgggttatgagcatcggcaactgtcccgcacagagtggcagtgctgggcggtatgcagtaacactctttataccattgccctgttaatactccgcactatgctcctgtcaggcttgcagttatgactgctgcctataaactttggactttttagggattatgaaattggagatcaagtgctttattatatgtaaagtgttaccacttgtttggctaaacatggcacagattcagcaagttggagctccagaggagaaggagaagacaactgccttaaaggatctgctttcaagaatagatttggatgaactgatgaaaaaggatgagccaccacttgagtttcctgatacattggaaggatttaactatgcctttaacgaattgggacaactaagacacattcagaccggagatccatttgtcttcaattatcgggaagatttacacagatggaaccaaaagcgttatgaagcccttggagagattatcacaaagcatgtctatgaattgctggagaaggactgtgaactagagaaagtatatttgccggtagatgctactgacagcgagccaaggagttttatttttatgagcaaagatgcaatgacgaatccagacaaaatgttagttttaatacatggaagcggtgttgtgcgagctggacagtgggcacggagacttataataaatgaagatctgaacagcggttcacagataccttatatcaaaagagcaatgaaagaaggctatgcagttattgtgctaaatcctaatgaaaactacattgaagtggaaaaaagcaaagtcccagcagatcagccatctccagacagttctgatgaacctgcagagaagagggagaggagagagagaaatccaaaggaaactaagaaacggagggacttctatgaaaaataccggaatccccaaaaggaaaaggagaccctgcaagtgtacattagagataatggctctccagaagaacatgccttatatgtatgggacaatttcatttcaaaagcagctgctgaaaatatattatttgttgcccacagctatggaggccttacatttgtagaactgatgattcaacgcgaagctgatgtgaaaaataaagttgctgctgtggctctgacagattctgtgcataatgtgtggcatcaggatgcaagtaaaacgcttcgagaatggatgcgagagaactgctgtaattgggtgtccagcagcgaacctttggacacatcagtggaatcgacattaccagactgcccacgtgtatcagcaggaaccgagcgccatgagttgacctcttggaagagtttccactccatcttcaagttttttgacgacgccctacaagcgaagaacacaaaaaccaagccaacaccgacccggcgctctaacagaataaagcatgaagatctgtaaaatgcaacatgggggtgggtggggtgaccgggatgcccctcaaactctccaccagctcagttttcccactttctcatctgtcattagattgttttcttccaagagcacagggtcatgatgtatacatttaaatagcattttgcattatttctagatgagtgcagctgtcaaagcaatatgggttcactggttgtgcttcctgtggactgctgcttggattgtgtgccgcccatcagagcacagattaaggctgacagtcgcactgcactgtacagcatggtgcaagcctaattgcccttccatagccctgcactgagctgatgccatcgtacgtttgcttccccagtgcccccacattttaactcagtgtgcatcctgcttaactcctactgcgctaggcaggacccaatgccttcgcaatctagcaaagaagagtattttaaccttaattacccccttttcatcttctctctttcacaagcatgattactttgtgatttgctttctgagttacattttatattgaagccttcaagtgcagatgagggtgggggctcattttagctcaactgtttgatgccaacagagaagagaagatgttccaatgacattgcggtgtcattcctgccccgtgtcacccagaaaagtgatccgagccccatgagcatcattttgccttttctttagttaatctcatggacattttgcttccaaaaagccatgcatcgcaggaccacccagcagtgaaaatgttaatgctcggttccagggtggaacactagtctcatcctagtgcatactcatgctatttggggttgctttttcaaccttacttatactgttaacccttttttatggcaaaagaaaaggtatattttaagataggacaaacaatggcagatacatttttaaggcatagatagttatactcggggttagaacaataagagcatttgtgattgttgcttccagcagatgtaaacacaagggtttctccagcacccaagctgttaaacccgcttaaatcatatcaatgttgcttagctactgaaaaaaaaaggacttgggtccatgttaataagactataaatatttcattatttgtatttgtatctcctccggtttaaggccactgacctccatttccatgggaagtcaacccttaaaattgtgaatcgctttttggacctattttttcttaaaacaatttttcttggtggcagaaaatctgattttatcgttaaccctgtccttttacaagctggattattattattattatttttttaactttgaaacactgtgaaccacagaggcaagaaaaaaaaatgtggtgcaaatttggtgttaaatgtaaagctgattccagtaatgatccagagtgggattgtatctccagagctcgtgtctaatgggtgtacatggcagccttctaatttatgctgtttttaagatgaataatttgctttccacattactgtctgttacctttgcaaatgtatttctcaccttttatctttttgggctgaaatcatttttttaagcacagttgctaaacataaactttgctgatctgtgtagcgtgccgagtcccaatgaatgatcacgttgatgtcccaatgaattgaatagtgctgctaaagatgctgtttttttaattaaaaaaaaaaaaagtgttttttgtacagagtacattttaaccaatacattgtataagagaattccagaaataaatgggcaagcacacagaagcttcttaatcaactcaaaaaaaaaaaaaaaaaaaaaa
Translation: MAQIQQVGAPEEKEKTTALKDLLSRIDLDELMKKDEPPLEFPDTLEGFNYAFNELGQLRHIQTGDPFVFNYREDLHRWNQKRYEALGEIITKHVYELLEKDCELEKVYLPVDATDSEPRSFIFMSKDAMTNPDKMLVLIHGSGVVRAGQWARRLIINEDLNSGSQIPYIKRAMKEGYAVIVLNPNENYIEVEKSKVPADQPSPDSSDEPAEKRERRERNPKETKKRRDFYEKYRNPQKEKETLQVYIRDNGSPEEHALYVWDNFISKAAAENILFVAHSYGGLTFVELMIQREADVKNKVAAVALTDSVHNVWHQDASKTLREWMRENCCNWVSSSEPLDTSVESTLPDCPRVSAGTERHELTSWKSFHSIFKFFDDALQAKNTKTKPTPTRRSNRIKHEDL
Donor tissue: gastrula