ORFeome > MGC89441 – XORFeome 2.0

MGC89441 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89441 protein, mRNA (cDNA clone MGC:89441 IMAGE:6990987), complete cds
Gene Symbol: MGC89441
Gene ID: 448432
ORF gb_acc: MG133860
ORF ID: 11442

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075533

Library Location

Plate ID: GDExt11014
Well Location: A08

EST Sequences

Clone: MGC:89441 IMAGE:6990987
Trimmed Sequence: ATGGAAGCCCAGGACCCAAGCAGTTACTACCTGCTTCAACCAACCCAAGCCTATTACCCATTTTCATACCATCAAATGATGAATGTGCCTTCGAATATGGATCTAGGAAATGAGCAGCAGACTCTGCATCCTCTAACTGGTGTTCCAGCCCATGAGCTGCAGGCTTTCTCTGGGATGGCTGCTAACGAACCTCAAGTGCTCCATACCCTCACTGGAGTGCAAGCCCAGGAACCTATAAATGGAGAGATGCAAGTCCCAGAGATGATTCCAAATCTTGCTGAAGCAGAACCCACAACGGGCAAGCGAAAAAGAGGCAAGGCTCCATCAGAGCCAAAACCAAAAAAACAAGCTGCAAAGAGTGCGAAAGCTCCAAAATCGTCTGGGAAGCAAGAGAAGATCACAGATACTTTTAAAGTGAAAAGAAAAGTGGATCGTTTTAATGGGGTCTCTGAAGCTGAACTCATGACCAAGACTTTGCCAGACATTCTAACATTCAACCTGGATATTGTAATTATTGGGATCAATCCAGGTCTTATGGCAGCATACAAAGGCCACCATTACCCAGGACCAGGAAACCACTTCTGGAAGTGTCTGTTCTTGTCTGGACTAAGTGATATGCAGCTTAATCATCTAGATGACCATTCACTTCCAGAAAAATATGGTATTGGGTTTACTAATATGGTGGAAAGGACGACACCAGGGAGCAAGGACCTTTCAAGCAAGGAATTTCGGGAAGGAGGGAGGATTCTTTTAGAAAAGCTGCAAAAATATAAACCTCGCGTAGCAGCATTCAATGGAAAATGTATTTATGAAATTTTTAGTAAAGAAATATTTGGGGTAAAGATTAAAAAGTTCGAATTTGGAATCCAGCCACACAGAGTCCCTGAAACAGACACAGTTTGTTATGTCATGCCTTCATCGAGTGCTCGATGTGCACAGTTTCCAAGAGCTCAGGACAAAGTCCATCACTACATTAAGCTAAAGGAGCTACGAAACCAGCTCAAGGGAGTAGAAAGCAGTCGGGAAGTCCAGGAAGTGCAGTACTCATTTGACCTGCAGTTAGCACAAGCGGATGCAAAGAGACAAGCTATAAAGGAGGAAAAATATGACCCTGGTTACAATGAAGCCACTGGAGAACAATTCAATGAGCAGACAACAAGCGGGGAAAGTGGAATGTGCAACTTCTCAACAGATGCCACAGTATCAAGCAATCCAGAGTTTAATGGGCAAGGTCAAAATGGACAATGGATTCCCCAGCCTGTTGCTGAACAGATGTCGACTTACAACCACAGTGGCGACCAACAGCAAGGAGGGAGCAACGCTTGA
Full Trace Sequence: ctgtagtctcggtgtggaatctcgtagctgttgcatttattttacagcagcatggaagcccaggacccaagcagttactacctgcttcaaccaacccaagcctattacccattttcataccatcaaatgatgaatgtgccttcgaatatggatctaggaaatgagcagcagactctgcatcctctaactggtgttccagcccatgagctgcaggctttctctgggatggctgctaacgaacctcaagtgctccataccctcactggagtgcaagcccaggaacctataaatggagagatgcaagtcccagagatgattccaaatcttgctgaagcagaacccacaacgggcaagcgaaaaagaggcaaggctccatcagagccaaaaccaaaaaaacaagctgcaaagagtgcgaaagctccaaaatcgtctgggaagcaagagaagatcacagatacttttaaagtgaaaagaaaagtggatcgttttaatggggtctctgaagctgaactcatgaccaagactttgccagacattctaacattcaacctggatattgtaattattgggatcaatccaggtcttatggcagcatacaaaggccaccattacccaggaccaggaaaccacttctggaagtgtctgttcttgtctggactaagtgatatgcagcttaatcatctagatgaccattcacttccagaaaaatatggtattgggtttactaatatggtggaaaggacgacaccagggagcaaggacctttcaagcaaggaatttcgggaaggagggaggattcttttagaaaagctgcaaaaatataaacctcgcgtagcagcattcaatggaaaatgtatttatgaaatttttagtaaagaaatatttggggtaaagattaaaaagttcgaatttggaatccagccacacagagtccctgaaacagacacagtttgttatgtcatgccttcatcgagtgctcgatgtgcacagtttccaagagctcaggacaaagtccatcactacattaagctaaaggagctacgaaaccagctcaagggagtagaaagcagtcgggaagtccaggaagtgcagtactcatttgacctgcagttagcacaagcggatgcaaagagacaagctataaaggaggaaaaatatgaccctggttacaatgaagccactggagaacaattcaatgagcagacaacaagcggggaaagtggaatgtgcaacttctcaacagatgccacagtatcaagcaatccagagtttaatgggcaaggtcaaaatggacaatggattccccagcctgttgctgaacagatgtcgacttacaaccacagtggcgaccaacagcaaggagggagcaacgcttgagactgggccgagttccaagctatgcaaacgctgcagttttattgcagtctcaaggaaccgaacctcagttacataactgaagcctttattttagtttttacattttacctctcaattttattctagtgaaatattagtgtagctcttacctaaaattaggtagttttaatgaattatactacattttttaggagaaaagcaaaaaaaaattagagtagcctttttgattttgtttttgtacatttgttttgtatttaacttcaactgtgcaatgcagttattcacaaactgcatgtcctggaccttttgataaaatgcttgagacaaggcagttgccacttgtgattccaccaagtggagcctttgtttggatatatattaaggtcggtgctataatgtaaggacatcacttgtactgaatattagagccacatgttataactggttcagcttaatgggtcaagatacttagagctatagtgaatgacagtaaaacaacatgatgcagttcagtcatagacttgcagcagattctgcatatagtagcatttgactaaggtgcttgtgctgtcagttgtttagtggaaaaaatatgcagaattgtttttttttctttttttttttttttatggatcctctctgagatatgggccagtctgtatcctttccagggtagctgaatctactttcagaagatcctgaaagtcacactgtgcaggaaggggccaggtcttgtagttgtactatggtttacaggagcacagtttaggcattcctggagtaggagtaaaagacattctgcatagagtgaaatgccatgctgaagaaagagtgaaatgtcctacatattatttttctcttactattcctacaaaggtgttctgtgtacttgaaatatatatatataacaaaataatttaaaacatctgattattttttttactgttattttaatcattcagtgtaggttcctatttattgtcttaaagttgcagtgcatgctcagtcactgcagtgtattaacttcagacttgtgtcctgagccgttgatataaggacgaactctgagaagcaaaaggtactgctgtttcttcacagtctgagataattcccaatagagccttcccagcttgtggctaagtgactattccgtagtgatgtattttatttcaccttatcaggcaaaatattgacctgatataaaaactcagtgaggaaatccatttctttttaaagtaaactttacccctaagtgttgcaggtctttataaaaatatagtcaatagaacagcctatatttatagcaatgtttcaaatttcaacttttatggtgcagtgtagaactaaataaatggggacagaaatgaactcagagcattgtatttgctatttttcttcaatatttaccccctttttcccctttagcacataataagattacagtatgtcaccctgcacctggtttcaagggttgccagtgcagaaaataagcattacatttaagatttactttagctcagcctaacaccactttgtcccattcctctcttaaatggctacttgcagtgagcagtgtaagaacctttactgcacaaaaactgggttcctagcatgacggttgtgtaaagctcacaagcagcactcttggtcagcagctagtgatctcacaaaacagtaaagctagttctatatgatagagttctgcatctgtttagaatacatggatttgaggcagaaaatccctgattccctgactgatgaggtgcaggttctaatctggaatttgtccccccacttttctcccaaggaaaatgatgaggtttttgaacctgattgatccacctcccaaagtgaagtcctctgtataccccctatatgatcaattagccccctgagccaatgaatggaccagcccaatttgtcctagcacataagtgttcaaataggacagattaatgtattgtgccatcttaacttgtgatcttagattagagtgagatgcctacattcttttatgtagtgcagagctagtttattttgtgcatgttttgagaacaatatgcattaaaccctgtctaagagtctgagcagaggatgtagctttttctgtacatattcagattcttacggcacatgaattgtcatcattagaaaaattgctgtagtttatgggtatgctggtatcataacttgtactgtttattgtaatataaaacacacttttgttaaaactggaccattatttgtttctattaatctaactagtgggggcagattatgagttcaggtacagaggcttggcacctctggttggcatatacaatgcattttttttttttttttttaaatgggtgaagagccctttaagccttgggtatgtttacttcaaaataaatatgttcaggtgcagactgtagtattccaagatgatatgtaactactcttctgtgggttttagtactgacttgctatatggtttgtgtgaccactgactgaataggaaagagcccagaataatcagacagatctggcctcccaatcactgtgctttccagtagctataatttattgtcccttgtaacatatcccaaatgcccatatatctgtctctgaagtctgcattggagaggctttttttctgtaacaagctacttatgcatgcaaaggtcattgtacccaccttcttttggtgccactcatgtctgtaagtgggtacatagctggagtcaccatgtacaggtaaccaaaacaataggacatagctatggaaagagatggtttatgctgagtagcaatacctaataactagatatgagctaactggacataatgcacatttatcagattcctgtatcatggttaaatatgtatcaattagtgagagaccagttcttaagcaagccctatgataaagaacagacactgctatctggattgatagtaataagggaattaaagagtttagcccttgattattttgtgactgtgtttatacatatgtgcaatagagacaaaccatgcctatgattatttcctacatgacacacatgtactgttggctttccattgctgaattaccactgttattgtttgggaactattgtaaatgtggtcagtcacttttttacagaataaaaacattcatgcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEAQDPSSYYLLQPTQAYYPFSYHQMMNVPSNMDLGNEQQTLHPLTGVPAHELQAFSGMAANEPQVLHTLTGVQAQEPINGEMQVPEMIPNLAEAEPTTGKRKRGKAPSEPKPKKQAAKSAKAPKSSGKQEKITDTFKVKRKVDRFNGVSEAELMTKTLPDILTFNLDIVIIGINPGLMAAYKGHHYPGPGNHFWKCLFLSGLSDMQLNHLDDHSLPEKYGIGFTNMVERTTPGSKDLSSKEFREGGRILLEKLQKYKPRVAAFNGKCIYEIFSKEIFGVKIKKFEFGIQPHRVPETDTVCYVMPSSSARCAQFPRAQDKVHHYIKLKELRNQLKGVESSREVQEVQYSFDLQLAQADAKRQAIKEEKYDPGYNEATGEQFNEQTTSGESGMCNFSTDATVSSNPEFNGQGQNGQWIPQPVAEQMSTYNHSGDQQQGGSNA
Donor tissue: gastrula