ORFeome > MGC89572 – XORFeome 2.0

MGC89572 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89572 protein, mRNA (cDNA clone MGC:89572 IMAGE:6994051), complete cds
Gene Symbol: MGC89572
Gene ID: 448470
ORF gb_acc: MG133936
ORF ID: 11529

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075584

Library Location

Plate ID: GDExt11015
Well Location: D10

EST Sequences

Clone: MGC:89572 IMAGE:6994051
Trimmed Sequence: ATGTCTCTTGTGAAGGAACGCAAGCCCAAAAAGCCTCACTACATTCCCCGGCCCCCAGGGAAGCCATTCAAGTACAAGTGCTTTCAGTGCCCGTTCACCTGCAATGAGAAATCTCATCTCTTTAATCACATGAAGTACGGCCTCTGCAAAAATTCCATCACGGTCGTCACTGACCAGGACCGGATCGTTAAAAACCCAAAAGTCAACTCTACGGACCAGAAGCAGCCAAGCAACGAACCCTTTGCTAAATCCCCCGTTCCTGCTATAAATGGACTTACCGGTCTGGAATCCAAAACCCAACACAGCGTAGCAAGGGAAGAAGCAAAGGAGAATTTTGATCTTAAAAATGAGGCCAAGCCCCATGTTGAGAAGACAACAGTGACCAAAGAAGTGACCCTGCCTCCAACAGCAATCATCGGTCAAATCAACAAGCCGCCAAGTCTGGACGGCGTTATGAGGCCTTCGGCCTTTATTCCAGTTGGGGAACACAGACTGAAGGGAACAGAGAATATAAAAATCCCTGAACTTTCTTCAGTTTCTACTGAACCAGCCAAAGGAGTGCACAGTATTAAATCTGCATTCCACAGTCTGCCGACCCCATGGAAATCTGGACTGGTTTCCCCTGACTTTAGCCACAAGTCTTCCATACCTCGTTATATCCGCCCAATGATCTCAGAATACCCTCCGCAATTTTATTCGGAAACGGGACTACCCGCAGTTTTTTCCCCATACTTGTTTCCACAGGCAGAGTGTGAGAATCCCATGCTCTCGGTCTACTCAGCACCAGAACAGAGGCCGTTCCTTCCGCATCCTCTGCAAGCTTCAGGATTACCTTTGCCAAAACCTATCAATGCACCTTTTGAGCATTACAGACTTCTACAACAGTTCCAGCAAAACCCCCAGTTGCATTATGGATTTTACAGGCCCACTGAACACCCATATTTTTCCTATGGCTTAAAGGTACCCCCTGTGCCCAGCCTCTCTAAAGAGCACACGTCTCAGTCGGTGGACAGTCCAACCTTTATCTACCCATCTTCGCATCCATCAAGGTTGTATCCTCTGGAAGGTTTTCAAAAGTTGGCCGAAATTCAAAAGGAAACATCCCCAGTTCCGGCCAAGAACCTTGACTCCAAAAGTGATTCTGAAAGTGTGAAAATGAGCCCAAGAGCAGGGAGTGCAGCAACTGGATCTCCTGGTAGGCCAAGCCCAACTAACTTCACCCAGAACAGCCAGGGGCATGAAGGCATCTTTGATCTCTCTACCAAGTCAACATCTGATAAGGCAGGAAAAGACTTCACAAGTGGCAAAGCTGTTAGGAAAAGCACAGACTGCCAGACAACGATCAGCAGAGAACACTCACCATGCTTCAGAAATGATGAAATCCAGTCCCACTCCGACTGCTACAGCGATGATGCCGCGCCTCATGACTCAGTTGCACCTCTTAACCTTTCCAAAAGGCCGGAGGTAGAGGACAGAGCGGTATTTGATACAATGCACAATAGTGACTCCAACGACGAGAGCGTAGGATTCATGGAGATTCAGGACTTGCCTTTAAACCTTTCAGTGAAAGACTCTGGCAATAACCAGAAAGCACTCTGTGCGGATGAAAGACTCTTGTTACCAAGACAAGTCACAAGCTCCCCAAATTATCACTTCATCCACACCGTAGACAAACGGGTACCCGCTACTACGGGTGTGCACTCCTTAGGCATCATTGAAAACTGCGATGAGCAAAAACAGTCGGCAGCGGTTGCCCTTTGCCAGCTAGCCACGTCCAGTCCTGGGGTACCGGCAAGAGGGACAGAGGATGAATTCTCAGAGAAAGAGACAGTCGCCCCCGAGCAGGTTCATCCAAGGGCCCCAGCAGCCCAAGAAACAGAGGCCGACATTGGTGCAAGGGGGCAGAAGCGAACAAACTCTAAGGAACCTGGGAAATCTCAAAGCTCAAATAAAAAACATAAATCTGTAGATTCTGGAAGGATGTTTACCCTGCGAAAAAGGCCAAGGGTATCGTAG
Full Trace Sequence: ggcaggcaacaggtacctctctgtgtgtgacagcccaggacacagcaacagctgccagttcctgctgaacctgctggaggttttggaggggggacggaagagcctctgacagaactggttcctcgtcgggcgtttggaagaacctgaaagactggaattgtgtttaagaagctgactgaggggaagagagcctgcctgacagcaccagttgtcattcccagtgctgaatagacgagaaaaatgtctcttgtgaaggaacgcaagcccaaaaagcctcactacattccccggcccccagggaagccattcaagtacaagtgctttcagtgcccgttcacctgcaatgagaaatctcatctctttaatcacatgaagtacggcctctgcaaaaattccatcacggtcgtcactgaccaggaccggatcgttaaaaacccaaaagtcaactctacggaccagaagcagccaagcaacgaaccctttgctaaatcccccgttcctgctataaatggacttaccggtctggaatccaaaacccaacacagcgtagcaagggaagaagcaaaggagaattttgatcttaaaaatgaggccaagccccatgttgagaagacaacagtgaccaaagaagtgaccctgcctccaacagcaatcatcggtcaaatcaacaagccgccaagtctggacggcgttatgaggccttcggcctttattccagttggggaacacagactgaagggaacagagaatataaaaatccctgaactttcttcagtttctactgaaccagccaaaggagtgcacagtattaaatctgcattccacagtctgccgaccccatggaaatctggactggtttcccctgactttagccacaagtcttccatacctcgttatatccgcccaatgatctcagaataccctccgcaattttattcggaaacgggactacccgcagttttttccccatacttgtttccacaggcagagtgtgagaatcccatgctctcggtctactcagcaccagaacagaggccgttccttccgcatcctctgcaagcttcaggattacctttgccaaaacctatcaatgcaccttttgagcattacagacttctacaacagttccagcaaaacccccagttgcattatggattttacaggcccactgaacacccatatttttcctatggcttaaaggtaccccctgtgcccagcctctctaaagagcacacgtctcagtcggtggacagtccaacctttatctacccatcttcgcatccatcaaggttgtatcctctggaaggttttcaaaagttggccgaaattcaaaaggaaacatccccagttccggccaagaaccttgactccaaaagtgattctgaaagtgtgaaaatgagcccaagagcagggagtgcagcaactggatctcctggtaggccaagcccaactaacttcacccagaacagccaggggcatgaaggcatctttgatctctctaccaagtcaacatctgataaggcaggaaaagacttcacaagtggcaaagctgttaggaaaagcacagactgccagacaacgatcagcagagaacactcaccatgcttcagaaatgatgaaatccagtcccactccgactgctacagcgatgatgccgcgcctcatgactcagttgcacctcttaacctttccaaaaggccggaggtagaggacagagcggtatttgatacaatgcacaatagtgactccaacgacgagagcgtaggattcatggagattcaggacttgcctttaaacctttcagtgaaagactctggcaataaccagaaagcactctgtgcggatgaaagactcttgttaccaagacaagtcacaagctccccaaattatcacttcatccacaccgtagacaaacgggtacccgctactacgggtgtgcactccttaggcatcattgaaaactgcgatgagcaaaaacagtcggcagcggttgccctttgccagctagccacgtccagtcctggggtaccggcaagagggacagaggatgaattctcagagaaagagacagtcgcccccgagcaggttcatccaagggccccagcagcccaagaaacagaggccgacattggtgcaagggggcagaagcgaacaaactctaaggaacctgggaaatctcaaagctcaaataaaaaacataaatctgtagattctggaaggatgtttaccctgcgaaaaaggccaagggtatcgtagtttggaacagcattaaggcttctatggaccattaaatatatgtgtatatatactgtagaccatgatattggggttaaaaaataaaaacttggtgagaaaaactggcagtttaaacatctaaacagtattaatcaaaaaaagactcactgcaggatacctaaatggtgtttaaagtttttatttctatataaactcctttgtccctctgttctggtcttcgttgtccctccgctacctaaggggtaatatatacctatataaattccattccagaagacaaagccaaaaagctaatatttagcagcaaaacctattttgaagtttcccatttttttatttttataggaagagagagtaaaaaaaggaaaattataaaaaaaaagaatgttttgctagctacaaagtacctcagctctgaaggaattctgctttgtattatctaatactattttgtaagtcatttctgtatatttatgtaaaaacgtgtgcataatattttttttttttaatgtgaaagctccatagttatctgcgagggcaccgcgctgtgctctttttgtgtaatatttatctatatattgtaatttatttttatataagcgagagcaatggtagcactagacctgtatatagtgaggggggaaagagcagataaatcaaatgtatttcttgggatgtaccactctttgcctttacgcatctgtttgaaactctcctaataaaatataaatatatttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSLVKERKPKKPHYIPRPPGKPFKYKCFQCPFTCNEKSHLFNHMKYGLCKNSITVVTDQDRIVKNPKVNSTDQKQPSNEPFAKSPVPAINGLTGLESKTQHSVAREEAKENFDLKNEAKPHVEKTTVTKEVTLPPTAIIGQINKPPSLDGVMRPSAFIPVGEHRLKGTENIKIPELSSVSTEPAKGVHSIKSAFHSLPTPWKSGLVSPDFSHKSSIPRYIRPMISEYPPQFYSETGLPAVFSPYLFPQAECENPMLSVYSAPEQRPFLPHPLQASGLPLPKPINAPFEHYRLLQQFQQNPQLHYGFYRPTEHPYFSYGLKVPPVPSLSKEHTSQSVDSPTFIYPSSHPSRLYPLEGFQKLAEIQKETSPVPAKNLDSKSDSESVKMSPRAGSAATGSPGRPSPTNFTQNSQGHEGIFDLSTKSTSDKAGKDFTSGKAVRKSTDCQTTISREHSPCFRNDEIQSHSDCYSDDAAPHDSVAPLNLSKRPEVEDRAVFDTMHNSDSNDESVGFMEIQDLPLNLSVKDSGNNQKALCADERLLLPRQVTSSPNYHFIHTVDKRVPATTGVHSLGIIENCDEQKQSAAVALCQLATSSPGVPARGTEDEFSEKETVAPEQVHPRAPAAQETEADIGARGQKRTNSKEPGKSQSSNKKHKSVDSGRMFTLRKRPRVS
Donor tissue: neurula