ORFeome > MGC89587 – XORFeome 2.0

MGC89587 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89587 protein, mRNA (cDNA clone MGC:89587 IMAGE:6994533), complete cds
Gene Symbol: MGC89587
Gene ID: 448644
ORF gb_acc: MG133953
ORF ID: 11549

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076989

Library Location

Plate ID: GDExt11015
Well Location: G06

EST Sequences

Clone: MGC:89587 IMAGE:6994533
Trimmed Sequence: ATGCCTAAGAAAGGGAACAGAAAACGGCTGAGGTTCAAGGGAGACGACGTGAGCTCTCATAGAGTTACTGTGGCAGACTGTGCAAATTCTGATCCAGCTGTTGTGAAGTCTGGAAGAATCAGAAAGTCTGTAGCTAATGCAATTCAGAAAGAAGTAAAGGCACTTTGTGGTTTGGAGGCCTCCTCTGTTGCCACTGAAGATGGACACTCCATTTTGTCAGAAAATGAGCAACACTCTTGTGATGAATTTAGTGCTATTGAAAATCTCAGAGAATTATCATCTAAAAAAAAGAAAAGTAAAAGACACAGAGAAAATAATGCAGTCGCAGAAACTGGGGCCAACTATCCGATTGATATCTGGCTTTTGCTAGCCTCTTACATTCGGCCTGAAGATGTTATGAATTTTGCCCTAATTTGCAAGAATGCTTGGATCGTTACATGCACAGCTGCTTTTTGGATAAGATTGTATAAAAGATATTATAAAATGAATGTCTACCTTCCAGTACGTTTACTTCCAGAGTGTATGTACAAGCTGCATTGTCTGCGCGCATGTGTAATCCGTTCCTTGTACCACATGTATGAGCCATTTTGTTCTCTGGTGGCTAAAAGTCCTCCAATTCCTGAACTTACCCCCGATACCTTGGCTAATTCGAAATGTTTACTTTTTTGGTACAAAAAAGCTGGAGGAAATCGATCTGAAAATATGTGGGAATTCAATTTTAAATTTAAGAAACAGCACCCAAAGCTGAAGAACCACTCTCTTAAAGAGCTGCAGCCACCTTCAAAATACAAGGAAGTCCACTTTAATCCAGATAATGACTGCTATCTTCTTCAGGTGTCCACTCTAAACTTTATTTTCATACCTATAGTCATGGGTATGACGCTTGCTTATTTCACAATAAATGTCAGTACTGATATGAGGCACCACAGGGTGAGATTAGTCTTTCAAGATTCTCCAGTGTGGAATGGAAAAAAGCCTCGTGGTGATCAAGGAGTGCAAATTGTTCTGGATCCTGTGCACACTGTCCATCTCCTGGATTGGTGGCATCCAAAATATCCCTTCTCATCCAGGGCTTAG
Full Trace Sequence: tttccatgatggctgcagatccaggttggattcagttgaattttattctagttttctcttcgctgtgtggggtgtagccatgagcacgactggcttccatttggttagaatccacttcatctccgacccgcctttgcccccagcatgcctaagaaagggaacagaaaacggctgaggttcaagggagacgacgtgagctctcatagagttactgtggcagactgtgcaaattctgatccagctgttgtgaagtctggaagaatcagaaagtctgtagctaatgcaattcagaaagaagtaaaggcactttgtggtttggaggcctcctctgttgccactgaagatggacactccattttgtcagaaaatgagcaacactcttgtgatgaatttagtgctattgaaaatctcagagaattatcatctaaaaaaaagaaaagtaaaagacacagagaaaataatgcagtcgcagaaactggggccaactatccgattgatatctggcttttgctagcctcttacattcggcctgaagatgttatgaattttgccctaatttgcaagaatgcttggatcgttacatgcacagctgctttttggataagattgtataaaagatattataaaatgaatgtctaccttccagtacgtttacttccagagtgtatgtacaagctgcattgtctgcgcgcatgtgtaatccgttccttgtaccacatgtatgagccattttgttctctggtggctaaaagtcctccaattcctgaacttacccccgataccttggctaattcgaaatgtttacttttttggtacaaaaaagctggaggaaatcgatctgaaaatatgtgggaattcaattttaaatttaagaaacagcacccaaagctgaagaaccactctcttaaagagctgcagccaccttcaaaatacaaggaagtccactttaatccagataatgactgctatcttcttcaggtgtccactctaaactttattttcatacctatagtcatgggtatgacgcttgcttatttcacaataaatgtcagtactgatatgaggcaccacagggtgagattagtctttcaagattctccagtgtggaatggaaaaaagcctcgtggtgatcaaggagtgcaaattgttctggatcctgtgcacactgtccatctcctggattggtggcatccaaaatatcccttctcatccagggcttagaatctaatcagagaagtcattgctgtgtgcagtttcaaccaaagaaaatccattatatccgtacagagccaaacaactgtgacactttcagtgccaaagagcaaacagccactgcttttcatctccacatgacttcaggtgcacctcctttggtgtgatcagtgttcaaaatgtttatacataggaaataaacaaaatgcacctaaaaaaaaaaaaaaaaaaaaa
Translation: MPKKGNRKRLRFKGDDVSSHRVTVADCANSDPAVVKSGRIRKSVANAIQKEVKALCGLEASSVATEDGHSILSENEQHSCDEFSAIENLRELSSKKKKSKRHRENNAVAETGANYPIDIWLLLASYIRPEDVMNFALICKNAWIVTCTAAFWIRLYKRYYKMNVYLPVRLLPECMYKLHCLRACVIRSLYHMYEPFCSLVAKSPPIPELTPDTLANSKCLLFWYKKAGGNRSENMWEFNFKFKKQHPKLKNHSLKELQPPSKYKEVHFNPDNDCYLLQVSTLNFIFIPIVMGMTLAYFTINVSTDMRHHRVRLVFQDSPVWNGKKPRGDQGVQIVLDPVHTVHLLDWWHPKYPFSSRA
Donor tissue: neurula