ORFeome > MGC89629 – XORFeome 2.0

MGC89629 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89629 protein, mRNA (cDNA clone MGC:89629 IMAGE:6995646), complete cds
Gene Symbol: MGC89629
Gene ID: 493502
ORF gb_acc: MG134377
ORF ID: 12066

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC081351

Library Location

Plate ID: GDExt11020
Well Location: E02

EST Sequences

Clone: MGC:89629 IMAGE:6995646
Trimmed Sequence: ATGAATCATTCTCCTGCCACCACCTTCTCTCCACATTCAAGGTATCAAGAACTGAAAGTAAGGAATAAAAAGTCCACCAAAAAAAGCCATAAAGAGAAGTACAGACTAAAATGTCTCCGTTTAAGACGTGTAGCCAAAGATATGGTGTTTGAAAATGCTGCTCTTTGTGATGAAATAGCACGCACTGAGGACAAATTTATCAGAGCGAAGGAGGAAAGAAGGTTTTTATTAAAAAGGCTGCTACAGTTGCAGGCTTTAAGTGAAGAAGAACCAGGCACATCACATAATTCCAATGTGTCAGCTGGTTACAGTGTACCAGACATGGCAGCGATGAATGAAGGAAATCTTGATATGTGCTATTCAAGTGTTCTTGATGATGGAGGTTCATGCAAGAAGGTGAAGAAGGATAAAAGAGAAAAGGGAAAGGAAAACAAATCAGAAGCTATGAAGAAACCTTCCAAGAAAAAAAGAGTCACAGAAGGAACAACTAGAAAGTGGGTTCAACCTATTGCTTTAGATCCATGTGGAAGGCCTGTGTTCCCAATAGTATTAGAAGGACTGACGGTTTATAGCCTTGGTGAGATTATTTCAGACCGTGCAGGATTTCATGAAAAAGTTGCCATTTATCCTGTAGGCTTTTGCAGCACTAGAGTTTACGTTGGCATGAAGAACCCTGATCAAAAATGCCTCTATACTTGCCAGATAAAAGATGGTGGCACAGGACCGCAGTTTGAGATTGTGCCTGATGATGATCCTCAGAATTCAATTGTGGCGAGTTCAGCCGACGAATGCCATTCAATTCTTCTGCAGAAAATCAGCACCCCTTTAGGGAAAAGGTTTTCTACACCGGATCTTGCTGGAGCATATTTCTTTGGATTTACTCATCCTACTATTCAGAATTTAATACAGAGTTGCCCTGGAGCACGGAAATGTACAGGTTACCAGTGGGTGAAATTTGAAGTATGCAGAGCTGGTGAAGAGCAAGTTCCTCGTGACATATGTGAAAGCAGTGCCTCCGTTAACTTTGAAGCCTTTCAAAGACAAAGTTTTGCAACAATAAACAATAGTACTGCCTTAGCAGGAACTTTGGATCTTCCAGAAATACATGCGTCACATGATTATATATCTACTTACCAGGAAATCTTCTTATCACATTCTCAATTGGCATCAGGCATGCAGCATTTAAAGTCACCTTCCAATCAGTACAGTCCGTCCAGGTCTTCAGAATAA
Full Trace Sequence: agaggcatgtatgagcttcctttgcgtcgggatagatcacattcggctaacagataggactttggcgagcataatgaatcattctcctgccaccaccttctctccacattcaaggtatcaagaactgaaagtaaggaataaaaagtccaccaaaaaaagccataaagagaagtacagactaaaatgtctccgtttaagacgtgtagccaaagatatggtgtttgaaaatgctgctctttgtgatgaaatagcacgcactgaggacaaatttatcagagcgaaggaggaaagaaggtttttattaaaaaggctgctacagttgcaggctttaagtgaagaagaaccaggcacatcacataattccaatgtgtcagctggttacagtgtaccagacatggcagcgatgaatgaaggaaatcttgatatgtgctattcaagtgttcttgatgatggaggttcatgcaagaaggtgaagaaggataaaagagaaaagggaaaggaaaacaaatcagaagctatgaagaaaccttccaagaaaaaaagagtcacagaaggaacaactagaaagtgggttcaacctattgctttagatccatgtggaaggcctgtgttcccaatagtattagaaggactgacggtttatagccttggtgagattatttcagaccgtgcaggatttcatgaaaaagttgccatttatcctgtaggcttttgcagcactagagtttacgttggcatgaagaaccctgatcaaaaatgcctctatacttgccagataaaagatggtggcacaggaccgcagtttgagattgtgcctgatgatgatcctcagaattcaattgtggcgagttcagccgacgaatgccattcaattcttctgcagaaaatcagcacccctttagggaaaaggttttctacaccggatcttgctggagcatatttctttggatttactcatcctactattcagaatttaatacagagttgccctggagcacggaaatgtacaggttaccagtgggtgaaatttgaagtatgcagagctggtgaagagcaagttcctcgtgacatatgtgaaagcagtgcctccgttaactttgaagcctttcaaagacaaagttttgcaacaataaacaatagtactgccttagcaggaactttggatcttccagaaatacatgcgtcacatgattatatatctacttaccaggaaatcttcttatcacattctcaattggcatcaggcatgcagcatttaaagtcaccttccaatcagtacagtccgtccaggtcttcagaataaggaggaaatactaaaatataatttattgcattgtatgttgacattttttcactggaaataacttgttcatgaaaaagctgtttgttatatgactgttccattgtgtcataataaaataattttccccacttttatacattaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNHSPATTFSPHSRYQELKVRNKKSTKKSHKEKYRLKCLRLRRVAKDMVFENAALCDEIARTEDKFIRAKEERRFLLKRLLQLQALSEEEPGTSHNSNVSAGYSVPDMAAMNEGNLDMCYSSVLDDGGSCKKVKKDKREKGKENKSEAMKKPSKKKRVTEGTTRKWVQPIALDPCGRPVFPIVLEGLTVYSLGEIISDRAGFHEKVAIYPVGFCSTRVYVGMKNPDQKCLYTCQIKDGGTGPQFEIVPDDDPQNSIVASSADECHSILLQKISTPLGKRFSTPDLAGAYFFGFTHPTIQNLIQSCPGARKCTGYQWVKFEVCRAGEEQVPRDICESSASVNFEAFQRQSFATINNSTALAGTLDLPEIHASHDYISTYQEIFLSHSQLASGMQHLKSPSNQYSPSRSSE
Donor tissue: neurula