ORFeome > MGC89642 – XORFeome 2.0

MGC89642 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89642 protein, mRNA (cDNA clone MGC:89642 IMAGE:7025750), complete cds
Gene Symbol: MGC89642
Gene ID: 448654
ORF gb_acc: MG133077
ORF ID: 10494

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC077001

Library Location

Plate ID: GDExt11005
Well Location: A06

EST Sequences

Clone: MGC:89642 IMAGE:7025750
Trimmed Sequence: ATGTTGGTTTTAGTATTAGGAGACCTGCACATCCCTCACCGTTGCAATAGCCTGCCTGCAAAGTTCAAAAAACTGCTTGTACCTGGGAAGATTCAGCACATTCTGTGCACGGGAAACTTATGCACCAAGGAAAGTTTTGACTACCTGAAGACTCTGGCTGGGGACGTTCACATTGTCAGAGGAGACTTTGACGAGAACTTAAATTACCCAGAACAAAAGGTTGTGACTGTTGGACAGTTTAAAATCGGTTTAATTCATGGCCACCAAGTAATACCATGGGGAGATATGGCTAGTCTGGCCTTGTTACAGAGACAGTTGGATGTTGATATCCTGATTTCTGGACATACACAAAAATTTGAAGCATTTGAACATGAAAACAAATTTTACATCAACCCAGGATCTGCTACCGGAGCTTACAATGCATTAGAAAACAATATTATTCCTTCCTTTGTACTGATGGACATCCAGGCCTCCACTGTTGTCACCTATGTGTACCAGTTAATTGGAGATGATGTGAAAGTAGAAAGAATTGAGTATAAAAAATCATAA
Full Trace Sequence: ccaatcagtgactgttcctcttctgtctgagcagaaacggagtgcaggatgttggttttagtattaggagacctgcacatccctcaccgttgcaatagcctgcctgcaaagttcaaaaaactgcttgtacctgggaagattcagcacattctgtgcacgggaaacttatgcaccaaggaaagttttgactacctgaagactctggctggggacgttcacattgtcagaggagactttgacgagaacttaaattacccagaacaaaaggttgtgactgttggacagtttaaaatcggtttaattcatggccaccaagtaataccatggggagatatggctagtctggccttgttacagagacagttggatgttgatatcctgatttctggacatacacaaaaatttgaagcatttgaacatgaaaacaaattttacatcaacccaggatctgctaccggagcttacaatgcattagaaaacaatattattccttcctttgtactgatggacatccaggcctccactgttgtcacctatgtgtaccagttaattggagatgatgtgaaagtagaaagaattgagtataaaaaatcataaaatagaactgccaactgtttcatggccttaattttttcattccatgaatttagctaatgagatggtcatgacaaaccctgcaaaagctataggcagataattagctatgtactaatatttgcattataacttcctctgaatttgctggaataggaatctgtacatcagataatttgttcttttaaatgtgttgcaaatcgtgtgccatgtttatttactatgtgaaaaaaaaaaaaaaaa
Translation: MLVLVLGDLHIPHRCNSLPAKFKKLLVPGKIQHILCTGNLCTKESFDYLKTLAGDVHIVRGDFDENLNYPEQKVVTVGQFKIGLIHGHQVIPWGDMASLALLQRQLDVDILISGHTQKFEAFEHENKFYINPGSATGAYNALENNIIPSFVLMDIQASTVVTYVYQLIGDDVKVERIEYKKS
Donor tissue: