ORFeome > MGC89895 – XORFeome 2.0

MGC89895 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC89895 protein, mRNA (cDNA clone MGC:89895 IMAGE:7029639), complete cds
Gene Symbol: MGC89895
Gene ID: 493514
ORF gb_acc: MG133130
ORF ID: 10571

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC081365

Library Location

Plate ID: GDExt11006
Well Location: A06

EST Sequences

Clone: MGC:89895 IMAGE:7029639
Trimmed Sequence: ATGTCAATGAAGTTTGAGCGCGCAGAGACCCCGTTGTGTGACAGTTCCAGTGTGAGGACTGCCCTGTCAGACCTGTATCTGGAGACCCTGCTGCAAAACCGGGGCTCAGCCAAGGGCTATCAAACCAGTGTCGGCTCTCACACAGAGGAGATTTACACAAATGGATCTGCAGCTTCAGGGACAGAGGAAAAGAAGAGAGTACGACTTGTTCAGTTTGAAAGAGAAACCGAAGAACCTATGGGTATTACGCTCAAGGTAAATTCACAGCAGAGCTGTATAGTTGCTCGCATCTTACATGGAGGATTCATTCACAGACAAGGTTCACTTCATGTTGGAGATGAAATTCTGGAAATTAACGGGAAAAGTGTCCGAAATCAAAGTGTGGATCATCTGCAGAGTGTTCTGAAAGAAAGCAAAGGGACCGTTGTTTTAAAAGTGTCACCATCACAGAGCAATCGCAAGCCCCCACTCCAGATGTATGTCCGAGCTCTGTTTGATTACAACCCTCTTTCTGATACACTGATACCATGTCGCGAGGCTGGCTTGGCCTTTCATACTGGAGATATCCTTCAGATCATAAACAAGGATGATTCCAATTGGTGGCAAGGACGTTTACAGGGTGAGGGGTCAGCTGGGCTGATTCCCTCTCCAGAACTTCAGGAGTGGCGTGTGGCAAGCTCCAGTACAACAAATCAGAATCCACAGAGTTGTAGTCCTTTTAGCAAGAAGAAGAAATGTAAAGACAAATACCTGGCAAAGCACAGTTCTATATTTGACCAGCTTGATGTAGTGTCCTATGAGGAAGTAGTATCTCTACCAGCTTTTACAAGAAAGACCCTTGTGCTGATCGGCGTAAGTGGGGTTGGACGCAGCCACATAAAAAATACTTTATTAGCCAAATACCCAGAAAGATTTGTGTATCCAGCACCACACACCTCCCGTCCCCCTAAACGCGGAGAGGAGGAGAGTGGCTCGTATCACTTTGTTTCAGCAGAGGAAATGAGCCGGGCAATCTCAGAAAATGAGTTCCTGGAATATGGCAGCTTTAGTGGATATATGTTTGGAACAAAGATCCAGACTGTGAAGGAGGTTCATAAAGATGGGAAAGTTGCTATTTTGGATATTGAGCCACAGACTCTGAAGATGGTTCGTACAGCAGAATTGGCTCCCTTTATTGTGTTTATTTCACCCACAGACAAAGAGGAGTCGGAGGCTCTGCAGAAGCTGCGTGCAGACTCAGATGTCCTTCGCTCCCGATATGCACAGCATTTTGACCTGACTCTAGTTAATAATGGAGTTGAGCAGACAGTGCAGGATCTGTTGGAAGCTTTTGATGCAGCCTGTTCTTCCCCTCAGTGGGTTCCTGTTACGTGGGTGTACTAA
Full Trace Sequence: ccccgagcctattccttgggagataaaggagaagaggcagaggggttcgatagtataaaccggtgcaggtttatacagtggaaacacctaggaaggcggaatacctcgtctcaggatgtcaatgaagtttgagcgcgcagagaccccgttgtgtgacagttccagtgtgaggactgccctgtcagacctgtatctggagaccctgctgcaaaaccggggctcagccaagggctatcaaaccagtgtcggctctcacacagaggagatttacacaaatggatctgcagcttcagggacagaggaaaagaagagagtacgacttgttcagtttgaaagagaaaccgaagaacctatgggtattacgctcaaggtaaattcacagcagagctgtatagttgctcgcatcttacatggaggattcattcacagacaaggttcacttcatgttggagatgaaattctggaaattaacgggaaaagtgtccgaaatcaaagtgtggatcatctgcagagtgttctgaaagaaagcaaagggaccgttgttttaaaagtgtcaccatcacagagcaatcgcaagcccccactccagatgtatgtccgagctctgtttgattacaaccctctttctgatacactgataccatgtcgcgaggctggcttggcctttcatactggagatatccttcagatcataaacaaggatgattccaattggtggcaaggacgtttacagggtgaggggtcagctgggctgattccctctccagaacttcaggagtggcgtgtggcaagctccagtacaacaaatcagaatccacagagttgtagtccttttagcaagaagaagaaatgtaaagacaaatacctggcaaagcacagttctatatttgaccagcttgatgtagtgtcctatgaggaagtagtatctctaccagcttttacaagaaagacccttgtgctgatcggcgtaagtggggttggacgcagccacataaaaaatactttattagccaaatacccagaaagatttgtgtatccagcaccacacacctcccgtccccctaaacgcggagaggaggagagtggctcgtatcactttgtttcagcagaggaaatgagccgggcaatctcagaaaatgagttcctggaatatggcagctttagtggatatatgtttggaacaaagatccagactgtgaaggaggttcataaagatgggaaagttgctattttggatattgagccacagactctgaagatggttcgtacagcagaattggctccctttattgtgtttatttcacccacagacaaagaggagtcggaggctctgcagaagctgcgtgcagactcagatgtccttcgctcccgatatgcacagcattttgacctgactctagttaataatggagttgagcagacagtgcaggatctgttggaagcttttgatgcagcctgttcttcccctcagtgggttcctgttacgtgggtgtactaaaaacttactaataggtgaatcccaaaaatcattgatcccattcagccatgaaaacttacccttggcccctaagaattactcaagtttaccacaaaagtctttcttcctatataaaacacataggagaacagggtaatctcttatcaactgcaatagaaaaccagttgtttagaaccgtgctgtcaagcttttgtgctgattataattatggacagccttgatctagattaagataatctgagtcttacaatgcattttgattccagaatacttaaacattgcccaaattgaacagatgacatctgggaacttttccaaacatacccacccagagaagccagtgacatcatttatcctaaactgttaggacacagcataaggttgccagatcatgtacaaaatgggctagtagagctgcactgattgaatttaattttaatgcaatatgtttgcaatcagctcatctcatctgaatttatagtttcacatgatttggtaacagtaacatagaggtcattgtgcagtgaagtatgccgtgtaaactcttagaaaaaaaaaaaaaaaa
Translation: MSMKFERAETPLCDSSSVRTALSDLYLETLLQNRGSAKGYQTSVGSHTEEIYTNGSAASGTEEKKRVRLVQFERETEEPMGITLKVNSQQSCIVARILHGGFIHRQGSLHVGDEILEINGKSVRNQSVDHLQSVLKESKGTVVLKVSPSQSNRKPPLQMYVRALFDYNPLSDTLIPCREAGLAFHTGDILQIINKDDSNWWQGRLQGEGSAGLIPSPELQEWRVASSSTTNQNPQSCSPFSKKKKCKDKYLAKHSSIFDQLDVVSYEEVVSLPAFTRKTLVLIGVSGVGRSHIKNTLLAKYPERFVYPAPHTSRPPKRGEEESGSYHFVSAEEMSRAISENEFLEYGSFSGYMFGTKIQTVKEVHKDGKVAILDIEPQTLKMVRTAELAPFIVFISPTDKEESEALQKLRADSDVLRSRYAQHFDLTLVNNGVEQTVQDLLEAFDAACSSPQWVPVTWVY
Donor tissue: