ORFeome > MGC97550 – XORFeome 2.0

MGC97550 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC97550 protein, mRNA (cDNA clone MGC:97550 IMAGE:5383973), complete cds
Gene Symbol: MGC97550
Gene ID: 595022
ORF gb_acc: MG134470
ORF ID: 12175

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC091590

Library Location

Plate ID: GDExt11021
Well Location: D03

EST Sequences

Clone: MGC:97550 IMAGE:5383973
Trimmed Sequence: ATGGCAGAAGGGGAAGATGGAACCTGGTGGAGAAGCTGGTTACAGCAAAGTTACAGTTCTGTGCGGGACAAATCTGCAGAGGCTCTAGAATTCATGAAGAGGGACCTGACAGAGTTTACCCGTGTTGTACAGCATGATACGGCATGCACTATCGCAGCAACAGCCAGTGTGGTCAAGGACAAGCTGGTTGTGGAGGGATCTTCTGGGACCACAGACAAAGTAAAGAAAGGGCTGTCCAACTTCCTAGGTGTAATTTCAGACACATTTGCCCCATCGCCTGACAAAACCATTGACTGTGATGTGATCACTCTTATGGCTACTCCATCTGGTACAACAGAACTGTATGACAGTACCAAGGCACGTTTGTACAGTTTACAGTCAGATCCTGCCACTTACTGCAATGAGCCTGATGGTTCCCCTGCAGAGTTTGATGCATGGCTTGCTTATTGGGACCCAGAACACAGAAAAGCAGAAATTTCTGAGCTTTTGGTGACAAGCCCATCTATCCGTGCTCTTTACACCAAAATGGTGCCAGCAGCTGTGTCACATTCTGAATTCTGGCAGAGGTACTTCTATAAAGTCCACCAGCTTGAGCAGGAGGAGGCACGGAGAGATGCCCTAAAACAGAGGGCCGATCAGAGTGTACATTCCGAGGAGCCACAGTGGGAGGAAGAGGAGGAGGACTTTGTCGGAGCTGCCTCAGCACCTAACTTCAAACTGGAAGAGAAATATGTGATATCGCCACCAACCATTCCAACCCTGCATGTTGAAGACAAATCAGAAAAAATGGCTGAGCTGAACAGAGACCACACCTCTATCACCAGTCCATCAGAGAGCAGTGAGAGCATTTCCCCTATAACTCAGATTGCGAACCCGGAATATATTGAGCAGACCGCTACAAAAGAGTCCAGTCCCAGGCCACTTACAGTAAAGGAAAAAAATGGAGCTGGAACAGATGAAAGCTCAGCTCATGCACCTGTAGAGCAAATAACAGGAAAATCTAATGCACAGATAGGGACTCACAGAGAAGACCCACCTTCTGATCTCCGTGTGTTTGAGTTAAACAGTGACAGTGGCAAATCTACCCCTTCTAACAATGGCCAAAAAGGCTCCAGCACAGATGTCAGTGAGGACTGGGAAAAGGACTTCGACATGACAGAGGAAGAAGTGCAGATGGCATTATCTAGGGTTGAGGTCTCTGGTGAGGTAGACGACGAGGACTGGGAGAACTGGGAATGA
Full Trace Sequence: cgaagatggcagaaggggaagatggaacctggtggagaagctggttacagcaaagttacagttctgtgcgggacaaatctgcagaggctctagaattcatgaagagggacctgacagagtttacccgtgttgtacagcatgatacggcatgcactatcgcagcaacagccagtgtggtcaaggacaagctggttgtggagggatcttctgggaccacagacaaagtaaagaaagggctgtccaacttcctaggtgtaatttcagacacatttgccccatcgcctgacaaaaccattgactgtgatgtgatcactcttatggctactccatctggtacaacagaactgtatgacagtaccaaggcacgtttgtacagtttacagtcagatcctgccacttactgcaatgagcctgatggttcccctgcagagtttgatgcatggcttgcttattgggacccagaacacagaaaagcagaaatttctgagcttttggtgacaagcccatctatccgtgctctttacaccaaaatggtgccagcagctgtgtcacattctgaattctggcagaggtacttctataaagtccaccagcttgagcaggaggaggcacggagagatgccctaaaacagagggccgatcagagtgtacattccgaggagccacagtgggaggaagaggaggaggactttgtcggagctgcctcagcacctaacttcaaactggaagagaaatatgtgatatcgccaccaaccattccaaccctgcatgttgaagacaaatcagaaaaaatggctgagctgaacagagaccacacctctatcaccagtccatcagagagcagtgagagcatttcccctataactcagattgcgaacccggaatatattgagcagaccgctacaaaagagtccagtcccaggccacttacagtaaaggaaaaaaatggagctggaacagatgaaagctcagctcatgcacctgtagagcaaataacaggaaaatctaatgcacagatagggactcacagagaagacccaccttctgatctccgtgtgtttgagttaaacagtgacagtggcaaatctaccccttctaacaatggccaaaaaggctccagcacagatgtcagtgaggactgggaaaaggacttcgacatgacagaggaagaagtgcagatggcattatctagggttgaggtctctggtgaggtagacgacgaggactgggagaactgggaatgaacactgcacagattgtgcatactgcgtgtacatctggacaattgatcaggagtctgaccctgtgtttgtcctttcatcttcacccacgtgctgctacaattgaacagcaaaagcccagttttcttacatctggccctgtaacaggcagaagtcagaagccagtgacagattacactggcactgtgggggttacctacttagattctgacatttatagcttgcgtattaaccccttcattgccagggccctgtgtacacaagtggagggttaaaaagtaccaagtgttaagattcagcctcgtataggttaaagcaagggttggggttgctaggatgtgtcttctgtattgctaatggttttgcagtagaagtctgatcttctagataaaagaataccaggtaaaggacatcctccctcattaatgacttgtgatggcctatacatctagatatacctttctctgtcatagttcagactgcgcctatcatgtttcactgcccttgcagctgcgttgtcttatattattaaaagcttagttgctgtatggcagcactgtgaggcagtataacaaagaacagagtgtatttgtacactcctgatctctccattgcgaggccagagtagctagagatctacttttattaagtaaggcaggaaaatactaataaacagggactgggaatagattatagaactgtgcagcaagcttatttctaaaaggtgtaaagaggagttgtcttttgcattctcattggtttaagcttgtaatacttgcaacaccgcactctttcaaaactgggtcccagttttgcattatgagccttagttatgtacagcaacctttattatagtgaactcctcatccttatagcctggtaattgtttgtgcaatataaaatatatatataaattctattttaagttatatggttgcagggaaaaggggctgttttccagcaaaaaagacacaaattgcttaggaacgctttaacagctttttctttttttcctcttttgtaattaagactttctcctgaatcttttacaaaacttgcacttgcctgctattaaagaaatgatgaggtgcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAEGEDGTWWRSWLQQSYSSVRDKSAEALEFMKRDLTEFTRVVQHDTACTIAATASVVKDKLVVEGSSGTTDKVKKGLSNFLGVISDTFAPSPDKTIDCDVITLMATPSGTTELYDSTKARLYSLQSDPATYCNEPDGSPAEFDAWLAYWDPEHRKAEISELLVTSPSIRALYTKMVPAAVSHSEFWQRYFYKVHQLEQEEARRDALKQRADQSVHSEEPQWEEEEEDFVGAASAPNFKLEEKYVISPPTIPTLHVEDKSEKMAELNRDHTSITSPSESSESISPITQIANPEYIEQTATKESSPRPLTVKEKNGAGTDESSAHAPVEQITGKSNAQIGTHREDPPSDLRVFELNSDSGKSTPSNNGQKGSSTDVSEDWEKDFDMTEEEVQMALSRVEVSGEVDDEDWENWE
Donor tissue: neurula