ORFeome > MGC97716 – XORFeome 2.0

MGC97716 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC97716 protein, mRNA (cDNA clone MGC:97716 IMAGE:6986294), complete cds
Gene Symbol: MGC97716
Gene ID: 548542
ORF gb_acc: MG134487
ORF ID: 12196

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090108

Library Location

Plate ID: GDExt11021
Well Location: B11

EST Sequences

Clone: MGC:97716 IMAGE:6986294
Trimmed Sequence: ATGGCGGCGCCCGTGGAGCGGCTGGCCGGGGTGTGTGCGGAATTGGAGCAGTGGCTTGGGGAGGAATCCGGGCAGAGAAATGACTGGGCGGAGGGGGAAGGGATCGTCTGGCGGCTCAGCGAGTTGTTTAGGGAAGCGCAGTACCGGGAGCTTGCGGAACCGCGGATATTCCGGCTGATCTTGCAAATTTTGTCTAGAGTTTCATGTGAGATCAAAGTGGCCACCTTGCCTGCTGGCGCTTTTACTGACACTCACTGCCAGTTACCTGCCGAATGTTTCCGCTGCTTGCGAAACGCCTGCGTGCAATGCGCGTCCAACCAGGACTCTGTTAGAAACGTGGGCTTGATTGAGGAATCTGTTCGCTTAATCCAGATTTTCGGTGCTCCCCATGTGCTTCAAGAACCTGCCTTAGTAGCTTTTCGTTGTGGCTTGCAATTCCTCGGCAACACTGCAGCCGGAAACCGGGATTCCCAGAATGCTGTTTGGGCTTGTGCATTTCCAGATCTCTTCTTGAGCTGCCTAGTGCACGATGATGAGAAGGTTGTAACCTACAGTTCGATGGTTTTATTTACGTGCATCAACCGTGAAAAGGTATCCACCCTACAAGATCCCTCAAAGCTCGACGTTGCGCTTAGTGTTGTCACTGCGTACAGTAAATACCCAGATGCAGAGTGGATGTACCTGATTGTCATGGACCATTTCCTCCTGTGCCCAGACCTGGTGAAAGCCGTGTATCTCAGCCAGAGCAGTCCGGAAAGGGTTACACTGTTGGAGCTCATTTTGGGCAAAATAAGTCAAAAAGAGCCACTTTCTGCCGAGGAGTCGGAGGCGTTACAGGCGATAGCGGCATTCCTGTCCGACTGCTTCCAAACCCAGTGCAAAACTATATTAAAACTGACATCCCCCTCTGCCTGCGACGAAGAGGAGCCCATAGTTGTAACCAGACTCCTGGATATTCTGTGTGAAGTGACTTCCAAGAATGAGCACCTTTCCTGTCTGCAGACCTGCCCCGGCCTGCTCGAGGCGGCAGTCGATATCCTGCGCCTGACGCATCTAGCGGGCAAACAGAGCATGAATGTCTTCACGGCCGCTCACACCATGTCCATGGGGCAGGATCTGACCCACGCCGCCGTGGGGTTTAAGGCTCACCTCATCCGTCTTATCGGCAACCTGTGCTACCAGAATAAGGAGAATCAGGAGAAGGTGTATCAGCTTGATGGGATTGCGCTTATTCTGGACAACTGCAGCATTGACGACAACAACCCTTTCCTGAACCAATGGGCAGTTTTCGCAATTAGAAACCTGACGGAAAATAATGACAAGAATCAAGAACTGATCGCGAGCATGGAGCGGCAAGGTCTGGCCGATAGTTCCCTGCTGAAGAGTATGGGGTTGCAAGCAGAGGAACGTGATGGGAAACTTCTCCTAAAGTCGGTCAAGAAATCCCCCGCCTTGTGA
Full Trace Sequence: cttgcgctgtcactctctgcccaatcacgtctcccgaatcgcggttgggctggccaataggtatccgacttcccgttgccatagcagcgcccacggcgggattccgagcaagatggcggcgcccgtggagcggctggccggggtgtgtgcggaattggagcagtggcttggggaggaatccgggcagagaaatgactgggcggagggggaagggatcgtctggcggctcagcgagttgtttagggaagcgcagtaccgggagcttgcggaaccgcggatattccggctgatcttgcaaattttgtctagagtttcatgtgagatcaaagtggccaccttgcctgctggcgcttttactgacactcactgccagttacctgccgaatgtttccgctgcttgcgaaacgcctgcgtgcaatgcgcgtccaaccaggactctgttagaaacgtgggcttgattgaggaatctgttcgcttaatccagattttcggtgctccccatgtgcttcaagaacctgccttagtagcttttcgttgtggcttgcaattcctcggcaacactgcagccggaaaccgggattcccagaatgctgtttgggcttgtgcatttccagatctcttcttgagctgcctagtgcacgatgatgagaaggttgtaacctacagttcgatggttttatttacgtgcatcaaccgtgaaaaggtatccaccctacaagatccctcaaagctcgacgttgcgcttagtgttgtcactgcgtacagtaaatacccagatgcagagtggatgtacctgattgtcatggaccatttcctcctgtgcccagacctggtgaaagccgtgtatctcagccagagcagtccggaaagggttacactgttggagctcattttgggcaaaataagtcaaaaagagccactttctgccgaggagtcggaggcgttacaggcgatagcggcattcctgtccgactgcttccaaacccagtgcaaaactatattaaaactgacatccccctctgcctgcgacgaagaggagcccatagttgtaaccagactcctggatattctgtgtgaagtgacttccaagaatgagcacctttcctgtctgcagacctgccccggcctgctcgaggcggcagtcgatatcctgcgcctgacgcatctagcgggcaaacagagcatgaatgtcttcacggccgctcacaccatgtccatggggcaggatctgacccacgccgccgtggggtttaaggctcacctcatccgtcttatcggcaacctgtgctaccagaataaggagaatcaggagaaggtgtatcagcttgatgggattgcgcttattctggacaactgcagcattgacgacaacaaccctttcctgaaccaatgggcagttttcgcaattagaaacctgacggaaaataatgacaagaatcaagaactgatcgcgagcatggagcggcaaggtctggccgatagttccctgctgaagagtatggggttgcaagcagaggaacgtgatgggaaacttctcctaaagtcggtcaagaaatcccccgccttgtgatgtaaaatggaaaggaggaggagaatgcagtgatccaaaaggaagaagcaatttttgcactaaagaagcagtatataggaaaaattaattcctcttatacgatttaaagactcttatggccctccaacatgtctcattctgtaggaggaactacgatagcaaaacatttcacccaatagtgtatgtttaaataataaaagtgcacccccaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAPVERLAGVCAELEQWLGEESGQRNDWAEGEGIVWRLSELFREAQYRELAEPRIFRLILQILSRVSCEIKVATLPAGAFTDTHCQLPAECFRCLRNACVQCASNQDSVRNVGLIEESVRLIQIFGAPHVLQEPALVAFRCGLQFLGNTAAGNRDSQNAVWACAFPDLFLSCLVHDDEKVVTYSSMVLFTCINREKVSTLQDPSKLDVALSVVTAYSKYPDAEWMYLIVMDHFLLCPDLVKAVYLSQSSPERVTLLELILGKISQKEPLSAEESEALQAIAAFLSDCFQTQCKTILKLTSPSACDEEEPIVVTRLLDILCEVTSKNEHLSCLQTCPGLLEAAVDILRLTHLAGKQSMNVFTAAHTMSMGQDLTHAAVGFKAHLIRLIGNLCYQNKENQEKVYQLDGIALILDNCSIDDNNPFLNQWAVFAIRNLTENNDKNQELIASMERQGLADSSLLKSMGLQAEERDGKLLLKSVKKSPAL
Donor tissue: gastrula