ORFeome > MGC97727 – XORFeome 2.0

MGC97727 – XORFeome 2.0

General Information

Species: Xenopus tropicalis MGC97727 protein, mRNA (cDNA clone MGC:97727 IMAGE:6986716), complete cds
Gene Symbol: MGC97727
Gene ID: 595029
ORF gb_acc: MG134486
ORF ID: 12195

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC091608

Library Location

Plate ID: GDExt11021
Well Location: C10

EST Sequences

Clone: MGC:97727 IMAGE:6986716
Trimmed Sequence: ATGGCTACTGACAAGCTGAAGAGTAAAGTAACCTCTGCATTTAAAATGCATGGCTTGCTGCTACGAGCAGAAGCCAGTAAATATCTCAGTGAAGTTTTAAGCTCTGTAAATGAAGTGGAGCTTGAAGATGTGATTGATAGTATAATAGATGCTGTAGAGAAACAGCCCTTGTCTTCTAATATGATTGAAAAGTCAACGGTGGAAACAGCTGTTCAGGAATGCAGTCGGTCCTGTGATGAAACCATTGAACATATTTTCAATATTATCGGTGCTTTTGACATACCCCGATATGTCTACAACTCAGAAAGAAAGAAATTCCTTCCCCTGAAAATGACCACACTCCCATCACCCAATCTCTTTGGAAGTGCAAGAGACAAAGCTGAGCTTTTTCGTGAGCGTTACACAATCTTGCAGCAGAGAACTCACAGACATGAACTCTTTACGCCACCTGTCATTGGTGCACATCCTGATGAAAGCAGGAGCAAATTTCAGCTTAAAACTGTGGAAACCCTTCTAGGCAACACTGCTAAAGTAGGCGAAGTGATTGTCCTGGGAATGATAACCCAGCTGAAAGAGGGAAAAATTTTTTTGGAAGATCCAACTGGAGCAGTACAGCTTGATCTCACAAATGCACAGTTTCACAGTGGTCTGTACACAGAGTCCTGCTTTGTTTTAGCTGAAGGTTGGTATGAAGACAAAATTTTCCACATCAATGCTTTTGGCTTTCCCCCTACTGAACCTTCCAGCACTACAAGGGCATATTATGGTAACATGAATTTTTTTGGTGGACCTTCTTCTACTTCAGTAAAAACTTCAGTTAAATTACGGCAACTGGAGGAGGAAAACGAGGATGCCATGTTTGTATTCTTATCTGATTTATGGTTAGATCAAGTTGAAGTTACAGAGAAACTTCACACAATGTTTTCAGGTTACTCAACAGCACCACCAACCTGCTTTATCTTCTGTGGAAACTTTTCTTCCGCACCTTATGGGAAGAATCACATCAGATCATTAAAAGACTCATTCAAAATACTGGCAGATATAATATGTGAATATCCGCATATACATAAAAGTAGTCGATTTGTTTTTGTGCCTGGCCCAGAAGACCCCGGTCCTGGTTTCATTTTACCAAGACCCCCAATTGCTGATCATATCACAGAAGAATTCCGCCAACGAGTGCCATTCTCCATTTTTACTACAAATCCCTGCAGGATCCAGTACTGTACACAGGAAATTGTTGTTTTCCGTGAAGACTTGGTAAATAAAATGTGCAGAAATTGCGTTCGTTTTCCCAACAACACTTTGGATATTCCAAACCATTTTGTCAAAACCATCTTATCCCAAGGACTTTTGACTCCACTTCCTCCGTTTGTCAGCCCTGTATACTGGGCCTATGATTATGCTTTGAGATTGTATCCGCTACCAGACTTGGTTGTCATCGCTGATAAATATGATCCGTTCACCATTACCAACACAGAATGTCTCACCATTAACCCTGGATCATTTCCAAGAAGTGGGTTTTCTTTCAAGGTCTACTATCCCTCCAGCAAAACAGCTGAAGACAGCAAACTTCAGAATCTTTGA
Full Trace Sequence: gggttcttggcgcgaacattctaacatggctactgacaagctgaagagtaaagtaacctctgcatttaaaatgcatggcttgctgctacgagcagaagccagtaaatatctcagtgaagttttaagctctgtaaatgaagtggagcttgaagatgtgattgatagtataatagatgctgtagagaaacagcccttgtcttctaatatgattgaaaagtcaacggtggaaacagctgttcaggaatgcagtcggtcctgtgatgaaaccattgaacatattttcaatattatcggtgcttttgacataccccgatatgtctacaactcagaaagaaagaaattccttcccctgaaaatgaccacactcccatcacccaatctctttggaagtgcaagagacaaagctgagctttttcgtgagcgttacacaatcttgcagcagagaactcacagacatgaactctttacgccacctgtcattggtgcacatcctgatgaaagcaggagcaaatttcagcttaaaactgtggaaacccttctaggcaacactgctaaagtaggcgaagtgattgtcctgggaatgataacccagctgaaagagggaaaaatttttttggaagatccaactggagcagtacagcttgatctcacaaatgcacagtttcacagtggtctgtacacagagtcctgctttgttttagctgaaggttggtatgaagacaaaattttccacatcaatgcttttggctttccccctactgaaccttccagcactacaagggcatattatggtaacatgaatttttttggtggaccttcttctacttcagtaaaaacttcagttaaattacggcaactggaggaggaaaacgaggatgccatgtttgtattcttatctgatttatggttagatcaagttgaagttacagagaaacttcacacaatgttttcaggttactcaacagcaccaccaacctgctttatcttctgtggaaacttttcttccgcaccttatgggaagaatcacatcagatcattaaaagactcattcaaaatactggcagatataatatgtgaatatccgcatatacataaaagtagtcgatttgtttttgtgcctggcccagaagaccccggtcctggtttcattttaccaagacccccaattgctgatcatatcacagaagaattccgccaacgagtgccattctccatttttactacaaatccctgcaggatccagtactgtacacaggaaattgttgttttccgtgaagacttggtaaataaaatgtgcagaaattgcgttcgttttcccaacaacactttggatattccaaaccattttgtcaaaaccatcttatcccaaggacttttgactccacttcctccgtttgtcagccctgtatactgggcctatgattatgctttgagattgtatccgctaccagacttggttgtcatcgctgataaatatgatccgttcaccattaccaacacagaatgtctcaccattaaccctggatcatttccaagaagtgggttttctttcaaggtctactatccctccagcaaaacagctgaagacagcaaacttcagaatctttgattttactgtgaaaatgatggaacactgctatttccatactggaggattttactaattcaattatgttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MATDKLKSKVTSAFKMHGLLLRAEASKYLSEVLSSVNEVELEDVIDSIIDAVEKQPLSSNMIEKSTVETAVQECSRSCDETIEHIFNIIGAFDIPRYVYNSERKKFLPLKMTTLPSPNLFGSARDKAELFRERYTILQQRTHRHELFTPPVIGAHPDESRSKFQLKTVETLLGNTAKVGEVIVLGMITQLKEGKIFLEDPTGAVQLDLTNAQFHSGLYTESCFVLAEGWYEDKIFHINAFGFPPTEPSSTTRAYYGNMNFFGGPSSTSVKTSVKLRQLEEENEDAMFVFLSDLWLDQVEVTEKLHTMFSGYSTAPPTCFIFCGNFSSAPYGKNHIRSLKDSFKILADIICEYPHIHKSSRFVFVPGPEDPGPGFILPRPPIADHITEEFRQRVPFSIFTTNPCRIQYCTQEIVVFREDLVNKMCRNCVRFPNNTLDIPNHFVKTILSQGLLTPLPPFVSPVYWAYDYALRLYPLPDLVVIADKYDPFTITNTECLTINPGSFPRSGFSFKVYYPSSKTAEDSKLQNL
Donor tissue: gastrula