ORFeome > mospd2 – XORFeome 2.0

mospd2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis mospd2 protein, mRNA (cDNA clone MGC:89651 IMAGE:7025900), complete cds
Gene Symbol: mospd2
Gene ID: 493504
ORF gb_acc: MG133074
ORF ID: 10491

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC081354

Library Location

Plate ID: GDExt11005
Well Location: C04

EST Sequences

Clone: MGC:89651 IMAGE:7025900
Trimmed Sequence: ATGGCTGAGGACAAGGAACAACTAATTCAGGAGACAAGAAAAAGGTTTACTCAGGAGTATCTGCAAGATAAGGCTGACAGATATGATTCTCGTGATGTGGAAAGACTACAGAAGGATGACACCTTGGTGGAAAGCTACCTTATGTGGAGGCATTATGTAACAGAGGAAGCTCTAAAGATGATGGATGAAAGCCTGAAATGGAGGAAAGACATTGGTGTAAATGACTTGAATGAATCCACTATCCCTAAGTGGTGTTTTGAGACTGGAGCATCTTATCTGCATGGATATGATAAAGAAGGCAATAAATTGTTGTGGCTCAAGGTAAAGCTCCATGTACGTGATGGTAAAACAACTGAGGACAAGAAAAAGTTTGTTGCATTCTGGTTGGAGCGCTATGCCAGGAGAGAACCAGGGAAGTTCATAACTGTTGTTTTTGACATGGTTGACTCAGGACTAAGCAATGTAGATATGGATTTTGTTCGGTTTGTCGTCAACTCTTTTAAGACCTACTACCCCAGATATCTGTCTAAGATGGTAATTTATGAAATGCCGTGGATATTGAATGCTGCCTTCAAAATTGTGAAAAGTTGGCTTGGTCCAGAGGCTATAAGTTTGCTGAAATTTGCAAACAAGAATCAAGTTCAGGACTACATCAGTGCAGAATACTTGCCACCTCATATGGGAGGAACAGATCCCTTCAAGTATAGTTATCCTCCATTGCCTGATGATGACTTTCAAACGCCACTGTGTGAGAATGGACCAGTAGCAAGTGAGGATGATTCCGAAAGTAAACTGAGTGAATCAGATCTCCGTGACACCGTAGATTTAAGTGTGCCAAAAAAGATAAGCATCAGCGACGACCAAATTAAACAGGAGGATGTGGAAAAAAATGATGTAAAGCAAAAAAACAACAGGAAGGCATCAACTGTATTCAAAGGACCTTTGTTACATATCAGTCCAGCAGAAGAACTGCATTTTGGGTCCAAGGAAAGTGGAGAGCGAAAATGTGTAATTGTGCTGAATAATGTAACAAAAAACACAGTAGCATTTAAGGTGAGAACAACAGCTCCTGAAAAATACAGAGTCAAACCAAGTAACAGCAGCTGCGAACCAGGATCCACAGTTGATATTGTGGTGTCTCTGCATGCAGCCTTTGTAGCATCTCTCCAGGACAGATTCTTAGTAATGGCGGCAGAAATGGAGCAGCCCTCCGGTGCCAGCACACAAGAACTCACACAGTTTTGGAAGGAGGTGCCCAGGAGTAAAGTCATGGAGCATAGGTTAAGATGCCACGTTGTTGAAACTAGCAAGCCTGCCTCATTAATCCTAAAATCAAACACAATGAACCACTCTGTATCGGACAGTGACGACTTGCATTTTAAGCTCAATCAGCTGTTGGAAACTAACAGAAGGTTAGAAGCACAGATGGGGCACTGCCTCTGGTTTCAGCACATGTTAGCCACCTTATTATCCATTCTGGTCGCCATTGTTGCTGCTGGAGTGTATATAACGAAACACCAGGACTGTTAA
Full Trace Sequence: gataactagatgagagaagcggtgtgtggcgatggctgaggacaaggaacaactaattcaggagacaagaaaaaggtttactcaggagtatctgcaagataaggctgacagatatgattctcgtgatgtggaaagactacagaaggatgacaccttggtggaaagctaccttatgtggaggcattatgtaacagaggaagctctaaagatgatggatgaaagcctgaaatggaggaaagacattggtgtaaatgacttgaatgaatccactatccctaagtggtgttttgagactggagcatcttatctgcatggatatgataaagaaggcaataaattgttgtggctcaaggtaaagctccatgtacgtgatggtaaaacaactgaggacaagaaaaagtttgttgcattctggttggagcgctatgccaggagagaaccagggaagttcataactgttgtttttgacatggttgactcaggactaagcaatgtagatatggattttgttcggtttgtcgtcaactcttttaagacctactaccccagatatctgtctaagatggtaatttatgaaatgccgtggatattgaatgctgccttcaaaattgtgaaaagttggcttggtccagaggctataagtttgctgaaatttgcaaacaagaatcaagttcaggactacatcagtgcagaatacttgccacctcatatgggaggaacagatcccttcaagtatagttatcctccattgcctgatgatgactttcaaacgccactgtgtgagaatggaccagtagcaagtgaggatgattccgaaagtaaactgagtgaatcagatctccgtgacaccgtagatttaagtgtgccaaaaaagataagcatcagcgacgaccaaattaaacaggaggatgtggaaaaaaatgatgtaaagcaaaaaaacaacaggaaggcatcaactgtattcaaaggacctttgttacatatcagtccagcagaagaactgcattttgggtccaaggaaagtggagagcgaaaatgtgtaattgtgctgaataatgtaacaaaaaacacagtagcatttaaggtgagaacaacagctcctgaaaaatacagagtcaaaccaagtaacagcagctgcgaaccaggatccacagttgatattgtggtgtctctgcatgcagcctttgtagcatctctccaggacagattcttagtaatggcggcagaaatggagcagccctccggtgccagcacacaagaactcacacagttttggaaggaggtgcccaggagtaaagtcatggagcataggttaagatgccacgttgttgaaactagcaagcctgcctcattaatcctaaaatcaaacacaatgaaccactctgtatcggacagtgacgacttgcattttaagctcaatcagctgttggaaactaacagaaggttagaagcacagatggggcactgcctctggtttcagcacatgttagccaccttattatccattctggtcgccattgttgctgctggagtgtatataacgaaacaccaggactgttaaatgtgttgttcatctcccagatgcgctgcctatgaaaccacctgtgagagaaatggatctgcccccacatgaccaaagatgccttcaaagcagtgttatgttgtataagacagctaattcataaagaggttacgacgttccccagacgtttaaatgatgccaatatttggtgtaactttgcttattgtctttagtggtaaagctgtgaaacagtaatgtaatgaagtacagctcgtagacaggccagccgccatgaccctgaatgttatattaatgtgagccttggatacttctcgtgataatatttaagtcctaagcagatgttggcaaatggtatgcactacaaaactcttatggatcctgtgaatttaccatatagactgctgctcatcttgcttatctttcttctagtttgcagttaaatgtttagttgccatagttcttacttgccataaataccggagcgtttagctgtccccagcaaaggtatttttttatcactaataaattagtggcgaacatttgctttaatttatgtgcaatcctcagcggcttacatcccatgagtcagtcggtgcatatagatgctgcgatactgtgctaactactaaaaccgtagaattcagtcacgccatgggtatttatttgctcttgtcatagatgaaacccaggaacccccagaggccatttgttaagaaggacagtattgacagaacattgcttttctgttacatggatgaaggataaatgcatatagtgcatcaagccaattataacctcaggtttcagtccctccttccctcgctgctactgataatgtaaataaatgtttttatgatactatttggtgtcatagtctcactgcttatgccttcttggatgacgtcctctatttttgtatataaatgaacatttgggcacccgtaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAEDKEQLIQETRKRFTQEYLQDKADRYDSRDVERLQKDDTLVESYLMWRHYVTEEALKMMDESLKWRKDIGVNDLNESTIPKWCFETGASYLHGYDKEGNKLLWLKVKLHVRDGKTTEDKKKFVAFWLERYARREPGKFITVVFDMVDSGLSNVDMDFVRFVVNSFKTYYPRYLSKMVIYEMPWILNAAFKIVKSWLGPEAISLLKFANKNQVQDYISAEYLPPHMGGTDPFKYSYPPLPDDDFQTPLCENGPVASEDDSESKLSESDLRDTVDLSVPKKISISDDQIKQEDVEKNDVKQKNNRKASTVFKGPLLHISPAEELHFGSKESGERKCVIVLNNVTKNTVAFKVRTTAPEKYRVKPSNSSCEPGSTVDIVVSLHAAFVASLQDRFLVMAAEMEQPSGASTQELTQFWKEVPRSKVMEHRLRCHVVETSKPASLILKSNTMNHSVSDSDDLHFKLNQLLETNRRLEAQMGHCLWFQHMLATLLSILVAIVAAGVYITKHQDC
Donor tissue: