ORFeome > mrpl39 – XORFeome 2.0

mrpl39 – XORFeome 2.0

General Information

Species: Xenopus tropicalis mitochondrial ribosomal protein L39, mRNA (cDNA clone MGC:97649 IMAGE:6980455), complete cds
Gene Symbol: mrpl39
Gene ID: 496829
ORF gb_acc: MG134407
ORF ID: 12100

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088527

Library Location

Plate ID: GDExt11020
Well Location: G11

EST Sequences

Clone: MGC:97649 IMAGE:6980455
Trimmed Sequence: ATGAGCCTGAATGTGGCGGGGAGATGCGCTGCCCGAGTGGCGTGTGGCAGATTTTACTCCACAGCCCCGGCTGCCAGACTCTCCACTGCGGATATCTCGAAGATGCACACGGAGCTGTTTAACAAAGAGAAGGAGCGCCAGCTGTCCCTGCACCCTCGCATCGAGAAAATAGAAGTGAAGCATGTTGGGAAACGGGATCATGGAGCCGTGGGCCTCATGAACAAAGGGCAGTCGACGCCATACCACTGCGCCTTGCATCTGAGCGAGTGGTACTGCTCCAGGTCAGTCTTGGCTCTTGTGGACGGGGAAGTCTGGGATATGTACAAGCCTTTGACTAAATCCTGCAACATCCAGTTTCTTACTTTCAAAGATGAAGACCCAGAAGAAGTAAATAAGGCATACTGGCGTTCCTGTGCCATGATACTTGGTTGCGTTTTGGAAAATGCTTTCAAAGAGGAGTATATGGTGAATCTGATAAGAGCCCCAGAGATACCAGTGATCTCAGGAGCGTTCTGCTATGATGTAGTACTGGACAGCAGGCTGGATGACTGGCGCCCAACAGAGGAGAATCTCCGATCCCTCACTAGGGAAGCGCACAGCCTTATTCACAAGGACCTGCCGTTCGAGTCTTTGGAAGTAGAAGAGAAAGTTGCCAAGGAAATATTTCAGCACAGTCCTTACAAACTGATCATGGCTGAAGAAAAAGCATCTCAGAACCCCCAGGGACTGGTGACTGTGCACAGATTTGGTGATTTTGTGGACCTCACTGAAGGACCTCACATTCCAAGGACAAGTTTTTGTCAGCAGTATGAGGTGACAGCAGGCCATTCCCTGGCAAACATCCCATCTGAACATGTGCGCAGGTTCCAAGGGCTGTCTTTGCCATGGCATTTGAAGGCTCATCACACTGTCTGGAACAGGTTGCGGACGAGATCACAGAGACTGGTCACAGAAGAACACAATCAGGAGCCAGAACAGCCACCGAGTCCTGTGTAA
Full Trace Sequence: gacagacgagtccatgtgtagtgctctggctctgaatgtcactttggctggaggaaaattgctgctgaggagcgggatgagcctgaatgtggcggggagatgcgctgcccgagtggcgtgtggcagattttactccacagccccggctgccagactctccactgcggatatctcgaagatgcacacggagctgtttaacaaagagaaggagcgccagctgtccctgcaccctcgcatcgagaaaatagaagtgaagcatgttgggaaacgggatcatggagccgtgggcctcatgaacaaagggcagtcgacgccataccactgcgccttgcatctgagcgagtggtactgctccaggtcagtcttggctcttgtggacggggaagtctgggatatgtacaagcctttgactaaatcctgcaacatccagtttcttactttcaaagatgaagacccagaagaagtaaataaggcatactggcgttcctgtgccatgatacttggttgcgttttggaaaatgctttcaaagaggagtatatggtgaatctgataagagccccagagataccagtgatctcaggagcgttctgctatgatgtagtactggacagcaggctggatgactggcgcccaacagaggagaatctccgatccctcactagggaagcgcacagccttattcacaaggacctgccgttcgagtctttggaagtagaagagaaagttgccaaggaaatatttcagcacagtccttacaaactgatcatggctgaagaaaaagcatctcagaacccccagggactggtgactgtgcacagatttggtgattttgtggacctcactgaaggacctcacattccaaggacaagtttttgtcagcagtatgaggtgacagcaggccattccctggcaaacatcccatctgaacatgtgcgcaggttccaagggctgtctttgccatggcatttgaaggctcatcacactgtctggaacaggttgcggacgagatcacagagactggtcacagaagaacacaatcaggagccagaacagccaccgagtcctgtgtaacttttcttatggttttgtataaatgttaataaaaaaaaaaaatgagcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSLNVAGRCAARVACGRFYSTAPAARLSTADISKMHTELFNKEKERQLSLHPRIEKIEVKHVGKRDHGAVGLMNKGQSTPYHCALHLSEWYCSRSVLALVDGEVWDMYKPLTKSCNIQFLTFKDEDPEEVNKAYWRSCAMILGCVLENAFKEEYMVNLIRAPEIPVISGAFCYDVVLDSRLDDWRPTEENLRSLTREAHSLIHKDLPFESLEVEEKVAKEIFQHSPYKLIMAEEKASQNPQGLVTVHRFGDFVDLTEGPHIPRTSFCQQYEVTAGHSLANIPSEHVRRFQGLSLPWHLKAHHTVWNRLRTRSQRLVTEEHNQEPEQPPSPV
Donor tissue: tailbud