ORFeome > mtpn – XORFeome 2.0

mtpn – XORFeome 2.0

General Information

Species: Xenopus tropicalis myotrophin, mRNA (cDNA clone MGC:76285 IMAGE:5379385), complete cds
Gene Symbol: mtpn
Gene ID: 395043
ORF gb_acc: MG132829
ORF ID: 10178

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064885

Library Location

Plate ID: GDExt11002
Well Location: B08

EST Sequences

Clone: MGC:76285 IMAGE:5379385
Trimmed Sequence: ATGGGTGACAAGGAGTTCGTGTGGGCCATCAAGAACGGAGACCTGGATGCAGTGAAAGAATTCGTACTTGGGGGCGAGGATGTGAACCGGACGCTGGATGGTGGAAGGAAACCTATGCACTACGCTGCCGACTGCGGGCAGGATGAGGTCCTGGAGTTTCTTCTCTCGAAAGGAGCCAACATCAATGCTGCGGATAAACATGGCATCACCCCCCTACTATCTGCCTGCTACGAGGGCCATCGCAAATGTGTCGAGTTGCTTTTATCTAAGGGAGCCGACAAGACGGTGAAGGGCCCAGACGGACTCAATGCTTTGGAATCTACAGACAACCAGGCTATCAAAGATTTGCTCCATTAA
Full Trace Sequence: cttttcctcctcctcctcctcctccagctccagctccagccatgggtgacaaggagttcgtgtgggccatcaagaacggagacctggatgcagtgaaagaattcgtacttgggggcgaggatgtgaaccggacgctggatggtggaaggaaacctatgcactacgctgccgactgcgggcaggatgaggtcctggagtttcttctctcgaaaggagccaacatcaatgctgcggataaacatggcatcacccccctactatctgcctgctacgagggccatcgcaaatgtgtcgagttgcttttatctaagggagccgacaagacggtgaagggcccagacggactcaatgctttggaatctacagacaaccaggctatcaaagatttgctccattaatggcctgccgagtggcctctgatttgcctcttgtgtggcctctcgctgctgcctgtctctctctctctgtctcttcatctccccgtctcttctcacagtcgtaggctaaaatcctcgagccctgtctcttcctttcctggagtccattccgtgcctgaatagagccaactgattggactacagggaactgagaacctcttgctttatcctgcagaagatattcttagggcccccccttgtaatgcctttaggggccaatagcagagattctcaattctaattatggcatttttatagcaccccctttctaaaaagcattagcctctagctccccctgacagcaggagggccacataaccaccttttctattataaagggttaatcgcctctacccacccctcttccttccccacttattctcctcttttgagcatttttggggttaaactgccccagcggttgcctatcgatccaccggatcctttatgcacttaagccgattgcacttaccctttaaagcgaacgtcattggccaaggtcggcggtaaggggcaacggtcggcatttaaagccccctcatctttacctcggatcccccgtaggctttaaacacagtctggctttgaaaatatcattgaataaggatatggggaggggcttaacaaggacatttctggggatcactgacaatctgcttttttttcccattgattctaatttaggggtaacgatcgcacgtaacaagcgcctaattgctctttttttgggggggggggacagatcctcagtttgtttaatgcatgataatccagggggggggggggttctgccttttatttctgcatttgtcttgctttgaggtattgaatgtaacttacagggagcctttgggggctccggggggggcggctggtgtttgtttggcctcacctagagccggcgaggggaacccagcggccttaccgttatgatatttttttaataggcttcgttaaaatcgccagatgctctcttgcaattggttaatttgacccccccccccccccgccacattcgcattcatgtccgtatcaaggaggctgaattaaatttgaacttgataataacaaaaaaaaaaaaaaaaaa
Translation: MGDKEFVWAIKNGDLDAVKEFVLGGEDVNRTLDGGRKPMHYAADCGQDEVLEFLLSKGANINAADKHGITPLLSACYEGHRKCVELLLSKGADKTVKGPDGLNALESTDNQAIKDLLH
Donor tissue: tailbud