ORFeome > myadm – XORFeome 2.0

myadm – XORFeome 2.0

General Information

Species: Xenopus tropicalis myeloid-associated differentiation marker, mRNA (cDNA clone MGC:79604 IMAGE:6979306), complete cds
Gene Symbol: myadm
Gene ID: 448507
ORF gb_acc: MG133593
ORF ID: 11130

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076668

Library Location

Plate ID: GDExt11011
Well Location: A09

EST Sequences

Clone: MGC:79604 IMAGE:6979306
Trimmed Sequence: ATGCCGGTCCAACACAGAACCATAGTGGTGGGCAACACCAGCACACTGAAATCACCGGTGGGCATCGTCCGTATCCTTGAAGTCATCTTCGCCTGCGTTACATTCAGCTTGGTGGTACACACTGGGAGATGGGGTGGCCGGATCGGAGATCTCTGTATGTTTTGCTGGTGTTTCTGCTTCGCAGTCACCCTGGTCATCCTGATTGTGGAATTCGCTGGGGTGCAGAACCGGATGCCCGTATCCTGGAAAAACTTCCCCATCACCTTTGCCATGTATGGTGTCCTAATGTGCCTCTCTGCCACTGTGATCTACCCCCTGCAATACCTAGAGGACAAGGCCTATAACAGCGAGGCACGCAACTACCAGATCGTGGCCATTGTGTTTTCCTGCCTCACTACCTTGGCTTACATTATTGAAGTGTCCTTAACCAGAGCCAAGCCTGGAGAAGTTACTGGGTACATGGCTACCACACCAGGACTCTTGAAGGTTTTGGAGACCTTCATTGCTTGCATCATATTTGTCTTTATCTCCGATCCAGCTCAATACGAGAGGCATGATGCCATGAAGTGGTGCTTAGCCGTCTATTGTATCTGCTTTATCTTATCCATTGTGGTCATTATCCTCTGTGTCGGCGAGTGCACAGGTTGGTTGCCTTGTGCTTTCAATAAGTTCCTAAGTGGCTATGCCCTCTTGGCAGTCCTTATGTATGCCTCCGCCATGATCGTCTGGCCAATCTTCGCATTTGACAGGAAGCATGGTGGAACCCCGAGCCGACCATCATACTGCCGGTCGGGCCAAGGAAACCTATACAGGGTGTGCGACTGGGATAAGTTGGTTGCTGTTGCTGTCCTGACAGCCGTCAACCTTATTGCGTACATTATGGACCTGGTTCATTCGGCCAGGCTTATATTCATCACCGTCTAA
Full Trace Sequence: cgctggctgtgtgactactcggcgtggccccgggctcccaggagccaggtttcagaatccgctgcattgcccgtcacgcttcttcttttcaagtagctccactctgcacataaggtacctcagccatgccggtccaacacagaaccatagtggtgggcaacaccagcacactgaaatcaccggtgggcatcgtccgtatccttgaagtcatcttcgcctgcgttacattcagcttggtggtacacactgggagatggggtggccggatcggagatctctgtatgttttgctggtgtttctgcttcgcagtcaccctggtcatcctgattgtggaattcgctggggtgcagaaccggatgcccgtatcctggaaaaacttccccatcacctttgccatgtatggtgtcctaatgtgcctctctgccactgtgatctaccccctgcaatacctagaggacaaggcctataacagcgaggcacgcaactaccagatcgtggccattgtgttttcctgcctcactaccttggcttacattattgaagtgtccttaaccagagccaagcctggagaagttactgggtacatggctaccacaccaggactcttgaaggttttggagaccttcattgcttgcatcatatttgtctttatctccgatccagctcaatacgagaggcatgatgccatgaagtggtgcttagccgtctattgtatctgctttatcttatccattgtggtcattatcctctgtgtcggcgagtgcacaggttggttgccttgtgctttcaataagttcctaagtggctatgccctcttggcagtccttatgtatgcctccgccatgatcgtctggccaatcttcgcatttgacaggaagcatggtggaaccccgagccgaccatcatactgccggtcgggccaaggaaacctatacagggtgtgcgactgggataagttggttgctgttgctgtcctgacagccgtcaaccttattgcgtacattatggacctggttcattcggccaggcttatattcatcaccgtctaagcgatgagacttcatggatagggtacgatatttccaactgcctgaacagaacatgaagggtttcgtacttgcaaaaatatgtacattcaacagcttgaacaatgcaccactgcctgcctgctaagctatttacctttgtatactgaggtatatacgtatatatatatatgtgattaaattcatcacaaccaatagtaaaaaaaaaaaaaaaa
Translation: MPVQHRTIVVGNTSTLKSPVGIVRILEVIFACVTFSLVVHTGRWGGRIGDLCMFCWCFCFAVTLVILIVEFAGVQNRMPVSWKNFPITFAMYGVLMCLSATVIYPLQYLEDKAYNSEARNYQIVAIVFSCLTTLAYIIEVSLTRAKPGEVTGYMATTPGLLKVLETFIACIIFVFISDPAQYERHDAMKWCLAVYCICFILSIVVIILCVGECTGWLPCAFNKFLSGYALLAVLMYASAMIVWPIFAFDRKHGGTPSRPSYCRSGQGNLYRVCDWDKLVAVAVLTAVNLIAYIMDLVHSARLIFITV
Donor tissue: tailbud