ORFeome > myo1f – XORFeome 2.0

myo1f – XORFeome 2.0

General Information

Species: Xenopus tropicalis myosin IF, mRNA (cDNA clone MGC:89346 IMAGE:6987813), complete cds
Gene Symbol: myo1f
Gene ID: 496494
ORF gb_acc: MG134361
ORF ID: 12048

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084472

Library Location

Plate ID: GDExt11020
Well Location: B08

EST Sequences

Clone: MGC:89346 IMAGE:6987813
Trimmed Sequence: ATGGGCAGTAAGGAGCGATACCATTGGCAGACGCAGAATGTGCGCCAGAGCGGGGTGGACGACATGGTTCTGCTCTCCAAGATCACCGAGGAGGCCATCATGGAGAACCTGAAGAAGCGCTACATGGACGACTACATCTTCACATATATTGGCCCCGTGCTGATCTCTGTTAACCCTTTCAAGCAGCTGCCGTACTTCACCGACCGAGAGATCGAGATGTACCAGGGAGCGGCCCAATACGAGAACCCGCCCCACATTTACGCGTTGGCCGATACCATGTACCGTAACATGCTGATAGATGGAGAGAACCAGTGCGTGATCATCAGTGGGGAAAGTGGCGCCGGGAAGACGGTGGCGGCCAAATACATCATGGGCTACGTCTCCAAGGTTTCCGGCGGGGGCCCCAAAGTGCAGCACGTAAAGGATATAATCCTGAAGTCCAACCCCCTGCTGGAGGCATTCGGCAACGCCAAGACCGTCAGGAACAACAACTCCAGCAGATTTGGCAAATACTTTGAGATCCAGTTCAGTCGGGGGGGGGAGCCGGACGGGGGCAAAATCTCCAACTTCCTCCTGGAAAAATCCCGCGTCGTCAGTCAGAACTCGGGAGAGAGGAGCTTCCATATATTCTACCAGCTCCTGGAGGGGGCATCGGCCGAGGATAAGGAGAATCTGGGCGTCACCTCCCCCGATTACTATTTCTATCTCAACCAATCGGCCGTCTATCACGTGGATGATGTCAGCGACAAAAAGGAGTTTGCAGAGACCATGCTCGCCATGGATGTGGTGGGACTGGGCCCTGACACCCAGACGTCGGTGCTACAGATTGTGGCGGGAATCCTCCATCTTGGGAACGTCGCCTTCACTGAGAGCGGGAACCATGCCGTGGTGGAAAGCCAGGACTTCCTGGCATTCCCTGCCTACCTCCTTGGCATAGACCAGGCCAGGCTGCAGGACAAACTGACCAGCAGGAAGATGGACAGTAAATGGGGCGGGAAGTCGGAAGTGATTGACGTGACGCTGAACGCTGAGCAGGCCTGTTTCACCCGCGACGCCCTCGCCAAGGCCCTGTATACCCGCCTCTTCGACTTCCTGGTGGAGGCCATCAATAAAGCAATGAGGAAGGACACGGAAGAGTATAACATTGGGGTGCTGGATATATACGGCTTCGAGATATTCCAGAAAAACGGCTTTGAGCAATTCTGCATCAACTTTGTGAATGAGAAACTGCAGCAAATCTTCATTGAACTGACGCTGAAGGCAGAGCAGGAGGAATACGTGCAGGAAGGGATCCACTGGAACCCCATCGAGTATTTCAACAACAAAGTGGTGTGTGACCTGATAGAGAGCAAAGTGAGCCCCCCGGGGGTAATGAGCATCCTGGACGACGTGTGTGCCACCATGCATGCCAAGGGGGAGGGCGCCGACCAGACCCTCCTACAGAAACTGCAGTCGGCCATTGGCAGCCACGAGCACTTCAACAGCTGGAACAGGGGCTTCATCATCCACCATTACGCCGGGAAGGTGTCGTATGATGTGAGTGGGTTCTGTGAGCGGAACCGGGATGTTCTGTTTGTTGATCTGATTGAGCTGATGCAGAGCAGTGAGATACCTTTCATCAGGGAACGATTCCCAGAAAACCTCAACGCTGAGAAGAAGGGGCGTCCGAGTACGGCCGGGAGCAAAATCAAGAAACAAGCCAACGATTTGGTACAGACCCTGATGAAGTGCACCCCGCATTACATTCGATGCATAAAACCCAATGAGACCAAGAAACCACGGGACTGGGAGGACAGCAGAGTGAAACACCAGGTGGAATATTTGGGGCTCCGAGAGAACATCCGGGTGCGCCGTGCCGGCTACGCCTACCGTAGAGTGTTCCAGAAGTTCCTGCACAGGTACGCCATCTTGACCCGGGAGACGTGGCCCCAATGGCGCGGCGATGAGAAGAAAGGCGTGATGCATCTGCTGCGCTCGGTCAATATGGACTCGGATCAGTACCAGCTGGGCAGGACCAAAGTATTTATTAAAGCCCCGGAGTCGCTCTTCTTACTGGAGGAGATGCGAGAGCGCAAGTACGATAATTACGCCCGCGTCATCCAGAAAGCCTGGCGCAAACACACGGCGGTGCGCAAATACATCCGAATGCGCGAGGAAGCCTCCAGTATCGTCCTGAACCAGAAGGAACGGCGCCGGAACAGCATCAACCGCAACTTCGTGGGCGATTACATTGGCATGGACGGGCGCCCCGAGCTGCGCCAGTTTGTGGGGCGCAGGGAGAGGATCGACTTTGCCGACGTTGTTACCAAATACGACCGCAGATTCAAGACGCTGAAACGTGACTTGGTCCTGACACCAAAGTTCCTGTATCTGATTGGTCGCGAGAAGGTAAAACAGGGACCAGACAAGGGTCAGATTAAGGAGGTTCTGAAGAGGAAGATTGAGCTGGAGAACATTCAGTCGGTGTCGCTGAGCAAATTGCAGGACGACTTCATCATCCTCCACGAGGGGGCGTACGACAGCGCGCTGGAGGGGGTATTTAAGACGGAGTTTCTCAGCCTTTTGTACAAACGCTACGAGGAGAAGACGCATCGGAAACTGCCCATCAAATTCGGCCTCCAGCTGGAGTTCAAGGTGAAGAAGGAAGGGTGGGCACCATGGGGGGCGGCAGGAACCCGACAGATCCAGTTCCAGACTGGAATAGGGGACATGGCGCTGACCAAGGCCAATGGGAAGGTTCTGATTGTCACCATTGGGCCGGGATTGCCCCCCAACTCACGGCCCACCCGTAAGGATAACCGGAAGAGCCAGTACATGGGCAGCGCGCCGGCCGGAAACCAGAGGGCCAATGGGGGCAATAAGAAGAGCTCGCGCCCCCCCATGTTGCAGAGAATGTCATTCACATCCAGGCAGAGTGTGGAGCAACCAACCTTACCCAGACAAGGGGCAAGCCCTCGAGCCAAGGCTCCGCCCACACAGGCCAACCTGGACTTCATGAATGTTCCGGATCAGGGCGCCGCGGGAATCCACAGGAGGCGTTCCAAGGAGGTCAAGCCCATCCCCGGTGGTGGAAGGTCCAAGCCCGCCCCCGCCCCCAAGCCCCAGCCCTCCCTGCCCCGCTGCCGGGCACTCTATGCCTACGATGCCCAGGACACCGACGAGCTGAGCTTCAACGCCAACGACGAGCTGGAGATCGTCAGGGAAGATCCCTCAGGTTGGTGGCAGGGGCGGATCCGGGGCAGAGAGGGGCTGTTTCCGGGCAATTATGTGGAGAAGCTCTAA
Full Trace Sequence: attctccaggtaaagcctcacctgcaggaaccgcccagggaaaaggcgatcactgggagcaactgagactgcaccgggggaggctgagactgccctgagagtggggagagacccaatatactggggttcggactgagactgccccccccccccccacacacacgcacacacaaggaaggggagattgagacttcaggattaattgccccactgggggagaaactaaaacttcctgggtgggagagagagacaccctgcctggaatgtgagtgagacactcagcctgggaagagcaacagtctgagactccggggaggagacaggagacatccacaatgggcagtaaggagcgataccattggcagacgcagaatgtgcgccagagcggggtggacgacatggttctgctctccaagatcaccgaggaggccatcatggagaacctgaagaagcgctacatggacgactacatcttcacatatattggccccgtgctgatctctgttaaccctttcaagcagctgccgtacttcaccgaccgagagatcgagatgtaccagggagcggcccaatacgagaacccgccccacatttacgcgttggccgataccatgtaccgtaacatgctgatagatggagagaaccagtgcgtgatcatcagtggggaaagtggcgccgggaagacggtggcggccaaatacatcatgggctacgtctccaaggtttccggcgggggccccaaagtgcagcacgtaaaggatataatcctgaagtccaaccccctgctggaggcattcggcaacgccaagaccgtcaggaacaacaactccagcagatttggcaaatactttgagatccagttcagtcgggggggggagccggacgggggcaaaatctccaacttcctcctggaaaaatcccgcgtcgtcagtcagaactcgggagagaggagcttccatatattctaccagctcctggagggggcatcggccgaggataaggagaatctgggcgtcacctcccccgattactatttctatctcaaccaatcggccgtctatcacgtggatgatgtcagcgacaaaaaggagtttgcagagaccatgctcgccatggatgtggtgggactgggccctgacacccagacgtcggtgctacagattgtggcgggaatcctccatcttgggaacgtcgccttcactgagagcgggaaccatgccgtggtggaaagccaggacttcctggcattccctgcctacctccttggcatagaccaggccaggctgcaggacaaactgaccagcaggaagatggacagtaaatggggcgggaagtcggaagtgattgacgtgacgctgaacgctgagcaggcctgtttcacccgcgacgccctcgccaaggccctgtatacccgcctcttcgacttcctggtggaggccatcaataaagcaatgaggaaggacacggaagagtataacattggggtgctggatatatacggcttcgagatattccagaaaaacggctttgagcaattctgcatcaactttgtgaatgagaaactgcagcaaatcttcattgaactgacgctgaaggcagagcaggaggaatacgtgcaggaagggatccactggaaccccatcgagtatttcaacaacaaagtggtgtgtgacctgatagagagcaaagtgagccccccgggggtaatgagcatcctggacgacgtgtgtgccaccatgcatgccaagggggagggcgccgaccagaccctcctacagaaactgcagtcggccattggcagccacgagcacttcaacagctggaacaggggcttcatcatccaccattacgccgggaaggtgtcgtatgatgtgagtgggttctgtgagcggaaccgggatgttctgtttgttgatctgattgagctgatgcagagcagtgagatacctttcatcagggaacgattcccagaaaacctcaacgctgagaagaaggggcgtccgagtacggccgggagcaaaatcaagaaacaagccaacgatttggtacagaccctgatgaagtgcaccccgcattacattcgatgcataaaacccaatgagaccaagaaaccacgggactgggaggacagcagagtgaaacaccaggtggaatatttggggctccgagagaacatccgggtgcgccgtgccggctacgcctaccgtagagtgttccagaagttcctgcacaggtacgccatcttgacccgggagacgtggccccaatggcgcggcgatgagaagaaaggcgtgatgcatctgctgcgctcggtcaatatggactcggatcagtaccagctgggcaggaccaaagtatttattaaagccccggagtcgctcttcttactggaggagatgcgagagcgcaagtacgataattacgcccgcgtcatccagaaagcctggcgcaaacacacggcggtgcgcaaatacatccgaatgcgcgaggaagcctccagtatcgtcctgaaccagaaggaacggcgccggaacagcatcaaccgcaacttcgtgggcgattacattggcatggacgggcgccccgagctgcgccagtttgtggggcgcagggagaggatcgactttgccgacgttgttaccaaatacgaccgcagattcaagacgctgaaacgtgacttggtcctgacaccaaagttcctgtatctgattggtcgcgagaaggtaaaacagggaccagacaagggtcagattaaggaggttctgaagaggaagattgagctggagaacattcagtcggtgtcgctgagcaaattgcaggacgacttcatcatcctccacgagggggcgtacgacagcgcgctggagggggtatttaagacggagtttctcagccttttgtacaaacgctacgaggagaagacgcatcggaaactgcccatcaaattcggcctccagctggagttcaaggtgaagaaggaagggtgggcaccatggggggcggcaggaacccgacagatccagttccagactggaataggggacatggcgctgaccaaggccaatgggaaggttctgattgtcaccattgggccgggattgccccccaactcacggcccacccgtaaggataaccggaagagccagtacatgggcagcgcgccggccggaaaccagagggccaatgggggcaataagaagagctcgcgcccccccatgttgcagagaatgtcattcacatccaggcagagtgtggagcaaccaaccttacccagacaaggggcaagccctcgagccaaggctccgcccacacaggccaacctggacttcatgaatgttccggatcagggcgccgcgggaatccacaggaggcgttccaaggaggtcaagcccatccccggtggtggaaggtccaagcccgcccccgcccccaagccccagccctccctgccccgctgccgggcactctatgcctacgatgcccaggacaccgacgagctgagcttcaacgccaacgacgagctggagatcgtcagggaagatccctcaggttggtggcaggggcggatccggggcagagaggggctgtttccgggcaattatgtggagaagctctaacagcacccccccaggcttctgatcctcgacttggggggtctccctgtccggctgatccagaacctccccagaggtaccgccgactccgcaaagtggcgccgccgccgcgcccggatttgtgtacagaaaccgagcgactttttaatgtgtttttagctttttttaaaacaaattttgctatttttttaatacataaggggccccgtgtaactgtggggcaggagcaggggctgtaggggcaggagcaggggctgtaggggcagatgcactaagccgccaattgcacgtaacccacaaacatttcatggacttgggacacaaagcgttaaagttctaatatttacccctcattttatctgccccccccctatcattattgcccctacagcgaccatgatccttcccatctctaactcaccaaataaaccaaattgtaccctgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGSKERYHWQTQNVRQSGVDDMVLLSKITEEAIMENLKKRYMDDYIFTYIGPVLISVNPFKQLPYFTDREIEMYQGAAQYENPPHIYALADTMYRNMLIDGENQCVIISGESGAGKTVAAKYIMGYVSKVSGGGPKVQHVKDIILKSNPLLEAFGNAKTVRNNNSSRFGKYFEIQFSRGGEPDGGKISNFLLEKSRVVSQNSGERSFHIFYQLLEGASAEDKENLGVTSPDYYFYLNQSAVYHVDDVSDKKEFAETMLAMDVVGLGPDTQTSVLQIVAGILHLGNVAFTESGNHAVVESQDFLAFPAYLLGIDQARLQDKLTSRKMDSKWGGKSEVIDVTLNAEQACFTRDALAKALYTRLFDFLVEAINKAMRKDTEEYNIGVLDIYGFEIFQKNGFEQFCINFVNEKLQQIFIELTLKAEQEEYVQEGIHWNPIEYFNNKVVCDLIESKVSPPGVMSILDDVCATMHAKGEGADQTLLQKLQSAIGSHEHFNSWNRGFIIHHYAGKVSYDVSGFCERNRDVLFVDLIELMQSSEIPFIRERFPENLNAEKKGRPSTAGSKIKKQANDLVQTLMKCTPHYIRCIKPNETKKPRDWEDSRVKHQVEYLGLRENIRVRRAGYAYRRVFQKFLHRYAILTRETWPQWRGDEKKGVMHLLRSVNMDSDQYQLGRTKVFIKAPESLFLLEEMRERKYDNYARVIQKAWRKHTAVRKYIRMREEASSIVLNQKERRRNSINRNFVGDYIGMDGRPELRQFVGRRERIDFADVVTKYDRRFKTLKRDLVLTPKFLYLIGREKVKQGPDKGQIKEVLKRKIELENIQSVSLSKLQDDFIILHEGAYDSALEGVFKTEFLSLLYKRYEEKTHRKLPIKFGLQLEFKVKKEGWAPWGAAGTRQIQFQTGIGDMALTKANGKVLIVTIGPGLPPNSRPTRKDNRKSQYMGSAPAGNQRANGGNKKSSRPPMLQRMSFTSRQSVEQPTLPRQGASPRAKAPPTQANLDFMNVPDQGAAGIHRRRSKEVKPIPGGGRSKPAPAPKPQPSLPRCRALYAYDAQDTDELSFNANDELEIVREDPSGWWQGRIRGREGLFPGNYVEKL
Donor tissue: gastrula